Description :
From Genome Similarity Track
Location :
Scaffold_1298:1- 5283
Sequence
5282 bases(100 bases per row)
TCGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCT
TTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATACCGTACAAACGGGAGAACGCGAATTAA
GATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCC
GGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGA
TCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGACCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCG
GGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTACTGGACCATTAT
GAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGT
ACGAGGCGACTACCGAGATCGAATCTCTCGCAGGGTTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAA
GATCCTGCAGAGGGATCGATGGGTTGAGATCCCAGCCAAGGAAGGGGGGGTTGGACTCAGCACGGGGGAAGATCCTCAAGAATCGGGCCCTTTAAAAATA
GCCCGGTTCGCGTGGAAGATAGGAATTGTCAAAGGGCTTAAGCCCGAACAGCCGAATTCGTCTGGATTCACAGTGGATCCAAGCTTTCCATTTGATAAAG
TGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTGA
TACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAG
CAAGTCTGTTACCATGAGGGCGGGGATCTACACGCCGAGGATCTGGTAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAGGTCACGA
TTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGG
TAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGACGCCTCAGTTC
CGAGAAAAACTGTCGGATCTGATTCAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTGAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGA
AGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGA
AGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATC
ACACCGTTATAACTGTTCGAATGGAACCGGATGCCGTTTGGATTGAAGAATGCGCCCCAGATCTACCAACGCCTGATCAATAACGCCCTCTATGGATTCA
CCCGAATACCGGAACCCGAAAAGGGGGGATCCGGAGAAGATCATACGGAAGTGGATCCATTCGAAACAGGAGAGCCAGGGGATCCTGGGACTCCATCTGT
GTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGCTGTGCGAAAGAGTGACATTCCTACTGGAGGCGTGTACTAAG
TGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTA
AGGACCTGTCTTCGTTAGCCGATTTGCCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGTCAGTTTGAACTACTACAGTCGGTTCATCGAGGA
TTACGCCCTGTTTGCCGCGGTATTGTACGAATTGAGAGAGGTAGATTTCGCCGCGATGACCACTCCAGCTGTCGGGAGAAATATTATATAAGCTCTGCTG
GGCCCGAGAGATATCGGATCCACAAAGGAATTCCAGTGGTACGACGCCAGAAGAGGACCTGAAAACAGGAGCTGGATCCCACCCCCGGGACCAACAGAGA
GAAGGATCTAGGCCTGGATAGAGACGAGGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAG
GATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTAAAA
GAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCTCC
TGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTT
GCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCC
GCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTTC
AGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCATACGACGCGGAGGCGGGGCGTCCAGTGCGATACTGTGGAGACTACCTGGATG
GGAAGTAGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGATAATGCTGGGTTTGGATCTACTAAAGGGACAA
GATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCTGCCCTAACACTGTTACGGC
AGAAAGTGATGGTCCACCTGCGTGGTTGGATGAATCACGAGTTGGTACATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTT
ACGGGATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAA
AGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGGTTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGC
GGATCCTCGAAGCACAGAACGAGAAGCGTGGATTTTGGGTATAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATGCCAAATCCTAC
AGTATTATCGCTACGGATTACGCAGTGGACCTGAATGACTTGCTCTTCTATTGCCCCCCCCCCCCCTACCAAAAGAGTCAACGAGGATCGAGATGGACGG
ATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGTATTGGTCGGACCTACCAAC
GGATCCGGGAATGTTTCCACTGGAGGGGACCTATCAAGAGCATACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGACCCACAAT
CGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCGTATCCCCTCGTTGCCCAAGTCGTTCAAAGGGAACACA
GAATTGTTGATTTGGGTGGACCTGTTTACCGGATATGTGATAGCCAAGGCTAGTGCATCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGTG
TTTTCCGAAGATTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCG
ACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTG
GATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATG
GGTGGGATCCCAAATCCACCCTGGAAGCGGCCATTCCAGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGCAATA
CTACCAGCAAGCTAGATCCCAGGTGAGCGAACGACTGCGGAGTGCGATACAGAATCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAA
GTGGGATCGCAGGTGTGGCTTTATTTGGATCGCGTGAAAGAGGTGTATGCCCGCAAATTAGCCCACCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGA
TTGGAGAACACGCGGTAAAGCTGGAAACGGTAGGTACCGAATACCGCCGGTTCACTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGA
TCGGCCGCAGATCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGCTCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGAC
GAGTTCGAAGTCGAGAGGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTAAATTTCTGGTGTATTGGCGTGGATATGACG
AACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAG