Description :
From Genome Similarity Track
Location :
Scaffold_1200:1- 5024
Sequence
5023 bases(100 bases per row)
CAAGGGAACGAAAACGGGGTGCAGTACTGCACCTGGTACTTCAGTGATACCCTACTTAAATGGAGGTTGGAGTGTTCGTTACCGCCAACGGAATAGAACC
ACAGAAAAAGACCTTCGAATCTTAAACATGTCCGTCACACAAAATTGTCGTGCCTGTCACGCTTTTCCGGACAAATCATTAAATAAAATAATTGAAATAT
TTCTACTGGCTGCCGAGCGCAGCGAAGGTGGCCCTGATTGGCCTAAAAGCTGCCGAGCGCAGCGAGGCTCGGCACCTTCTGCAACCCTGCGGGCCTTTGG
GCCCGCCTGAGCCACAATTTGCCAACTTACCGTGGGAGTAGTGAAGCGAGCCCGTGGCGAGCGGAACGGAGGCAAAAAACAAGGAACGACATTCATTCTT
ACCCGCCGCGTAGCGGCGGCACTCGGCTAGTATACAAAAAGTGTAGGACCACCAATTAAAACTGCACGATCACCAAAATAATTTAATCAGCTTCAACATT
GTGACAGCACCTTGCGCTAACTTTTGAGAGTTTACAAACTCTCAGTGCACGGCAGCTCACAGGTCCCCTTTGCCTAAAGGGAGCGAAGTGACCAATTTAA
GGTGGGCTGTAAACTGAGTATACTTATAGGTAGATAAAGCTTGGGTTTAATACAAACTATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATG
AAGTGTGTGACGGGGACACACAGCACCTTGCACAGAGGAAGTGCTTAAGGGTATTAGCTACCCGAGTGAACGTAAGTCCACGTGTTCCCGGCCTCAGTGG
GAGCGGTTTGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAACTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCT
CTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATTAGTTAC
CTATAGAAATGCAATGTCATTTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACGTGTCATACTCCTGAAGTG
TGAGGTGTCACACTTCATGTAGCCAGGGTACACTTAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTAAACCGACTAATCAGAATGAAG
AGGTGTTCGTCACAAACTCTCATTCTCAAAGTCGAAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAGTTAGAGCCTCGAGCAGCA
ACCTGTCGCTCTTCGTCTAGGTCTCCACTTTGACCGTTATCATGCCTCGTGGCACTGCAAAGCGCGGTGCTAAGACACGCTCCAAGGCTGCTGCCGGTAA
GGCGCAAGCCAAGAGCACTAAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGATCCTCGGGTGACGCGGCT
GTGGACAAGCGCGCAAGCAGGCGCCGCAGCCCGTCGCCCTCATCTTCAGACAATCGTCCGAACCCTCGGTTCGTGGAACATGAGTTCAACTCGGGCAGTG
AGGACGATGCCGAGTTCGAGAGCACTCATTATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGATGACAGCGTGCAGAC
GCCCGCTAGTGATCACGGTGATCACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGCTAAGGGCGCTCCCAAAGCCGGTGGCGATGAG
GAAGAGAATCCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACCGCCT
CTAAGTCTCCACTCCGCGAGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGA
GGAGGGTGCCATTGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTTGGTGGCG
GCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGAAGCTGACCTCTTCTTGGAGGTTCTCGTCGCTCCTG
GTGGCCTTGTGGGCGGCCACACTTCAAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAGCTTGGAGGCTGCTCGGTGTGT
GCTTCTCGCGCCACACCGCATTCCCCTTAAGGACGTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGG
GTTATGCCCGAGAACTGTCCCACGTGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCC
ATGAAGATCAGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCTAAGGGACATTCTGAA
GCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCGACCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCC
GCCGCTTCTGTTCCCAGATTGCGACAGCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTC
ACGAGGAGCTATCGCTTACCGCGACGCCGTTGCTCCTGGAGGATCCGCTCCACGTGAAAGTGGACTTCTTCATTCCGGTCAAGCAGGGGCGGAGGTGCCC
TCGTACGAGTACGAGTACTCGGCGCCTCCCGAGAGCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTC
AACGTGTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCTCAGGCCGGGAATCTGGCCGAGCTCGCTCGTCTTGCGGGTCG
CCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGAATGATCCGACGG
ATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACAATCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGTG
CCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGAC
GACTGTGACCAGCCCTCGCTTCGAGGAGCTGGGTCAAGGGGGGCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAA
CGTCGGGTGCGTCGTCATTGACTTTGAAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTG
TTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAACCTCAAATATACTTAAGTTTCCTCTTCCTTGTT
TGTCTGAGTACTTCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTT
CCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGATCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTG
AGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAGCTGGGAGCT
GCGTCGACCACGTACGTGGAGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGGTTGACGCGCTCTGTTTGGCCTTCGGTCTGCGGATGGTC
CGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGG
AGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCC
GACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCGGGAAGCCCAAAGATGAAAG
TCAAGACTCATCGACTTCAACAATCAGCCGGTACGGCAGGCTCTGTAGTGGAGCCGAAAGAGTCCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGT
CTTGACGTACCGGGCGACCCACATGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAAGGC
GATTCATCCGCCTCCGCGAGGATGTCGAGCTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACTCGATAATAGAGGAGGC
CCTCCTTCAACTCATATCGGCGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTCCCGGCCTTAAGGAACTTGACGATAGGCGC
GACAGCCGTATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGG
GCGTCCGCAAGCACGTTGAGCTT