Description :
From Genome Similarity Track
Location :
Scaffold_2588:1- 4751
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2588-snap-gene-0.1Dynein heavy chain

Sequence
4750 bases(100 bases per row)
GAGACACGATCACTCGGCAGACCGCGCGTAGTCCACTCGGCGATTTCCGACTCGGTCGTCAAGATCGCGAGCGGATTGCAGGGCTCGGACATTGGTAAGC
GCTCACGCTTGGTGGCAGAGATCACCACCGCTGTCTGGAGGAACGGGATCCACTTGTCACGGATAAGTCGATCGCGGTATGGCTTGGTGAACGCGCCCAC
GTACGAAACAAAGCACGCTGCGATCAGCACGTCACCAATGAGCTGGTCCGTCGAGGCCTGTAGCTTGTCCAGGTCGGATGCCCATCGCGCACTCTCGCTG
CCGAGCGCCGCGGTCAAACGCGTAGCCAACTGCATACGCAGCCTGCCGCGTTCGACAGCAGCGATCGCGGCTTCGACTTCGGCATTGGTCTCTTCAAACT
CTGCCGTGAGGGTCGCGAGCTTGGCCTCCAACGCATCCACTTTGCTTTGCACTTGTTCAAACCTTTCATTGGCGATCTGGAGCTTTTCGTTGGCTTCGGC
GAGTGCCTTTTTCTTGGGCTCGACCGTAATGATCGCATCGTAATATTGGACAATGTTGATGACCCAAGCACAGAGCCCCGCAGCCGCCGAGTTCTTCTTC
TCAATGACCTCGACGCTGAAATGTTCAAGCAGTAGAAACGGTCGGACTTCTTTCCAGTTGACCTCGGGCACCTGCTGGTCATCCACCAACGCCTTGAATC
CCACCAACTCGTCGACAAACGCATTGACGTTGCTCAACAAAACCTTCTTGCAGGCTTCCCAGGCCCGATCCTTGTCCTTGACCTTGCCGTTCTTTTGCAC
GACGATGTTTGGATTGATACCGGCAAAGAGCACGACGACCGCACCAAAGATATCGCCGACCCCGGCTGGTGGCTTCGTCATGGTCTTGCAGCTGCCCAAA
TCCTTCTTGTTGAGCGTATCGAGCGCCGCCATAGCCGCTTCAACCATGGGTTGCGCCAGCGCGAGATCGGCTTCAGTATCGGCCTTCTTGGCGGACACTT
CGGCCTGAATCACAGCACACTTTTCTTTCTCCACGTTGGCTTTGGCTGTTTCATTCTCGACAATGGCTTTGTCTTGGCGCAGCCGCAGCGCGATTTCTTC
GACCACAACCCTCTTCTTTTCTGCCTGCTCGAGTGTAGTCTTGAGTTCATCTTCCATATTGGCCACGACATCACGAGTGACTTCCATCTTCTCCAATCCA
CTCTGCAATCGACCCATCGCGCGCGTGTGGTGTTGTTGCTTCTCTATGAGCAGCTCCTTGTATAGCACAAGACACTCCAAGTAAGACTTTGGCGTGGAGT
AAACACGTCGCTTTTCGTTGGCAAGAAAGTCGTTTGCGACGTCATTCGTTGTTTGGAACGCTAGCGGCATAAAGCGTTCGATCGCGGCGAGGTAGTCGTC
GTTGCGAATCCACCGGCTTGAACGATCGTCCTCGACATTTATAAAGCGTGCAGCCACAGACTGGAGCGCGTCCTTGGGCCATGGCTGAAACCAATCAATG
CTCGTGCAGTTAACGAGCGCCGGGAACTTGCGAGCACGGACACGGAAGTCGCTAGACGCCGGTGAGAAGCAGAGCACAACGTGGAGATTGTGCCGGGTTT
CAGCCACAAAGAACTGCCAACATAGCTCTTTTTCAGAGAAATCACGAGATCCATTGGATCCACTGCCGTTGCCTGCGATGGCTCGGACCTTCGGGGCCAA
CTGCTGAACAATATTGGCTTGTTCGTCGCTGTTGAACAGATCGGGGATGTGGCCACTCGAGAGCAAGTCGTTCATTTGGACAAGCATGCGCTCGTGCTTG
ATCTGGCTGTCAGTGAGCATGAAGACAAGAGCCTCACCCTTGATTCCGGCTCGCATGACCAGTGCTTGAAGGTCTGTCTTAAAGTCCATTAACGAGTACG
CCTGGGTGATCGAGATCTCGACGAGGGAGTAACCGCAAATGAAGCAGCTCAGCCTCGCGAGCGACTTGCGACCACTGCCACCGACACCAACGAGCAGTGC
GTGGCCACCAGATCCCGGGTTGGAAAGAATTCTAACGATCCGTGTCACGTGGTCGAGAGCGTCTTTGAAGAGCACGAGCTCCATTTTCGTGAAGTGCTCA
TTGTGCTCTGCGAGTGCGTCTTCGACAGTTGCCAAGAGCGTGTCCGGCGAGGTCACTTGGTCATACTCGTTCGTGCGGAGCCCATTTGTAAAATGACAAA
AAAGAATTGACTCCCCAGCATTCGATCCATCCACTTGTGAAGAGGACGATCCTGATGACGGTAGAAAGTACTTGGTGAAGTTGAACGATGGGAAGCACTT
ACGAGCTTGTTGCTGCAACATCGACGTGAACTTGGCCAGATCAGTGGCGTTTACTAGTCTATCGCCGTACACACGTGCCGCCTCGTGGATCCACAGTAGC
GCAAATTTGAGCGGCTCATCAAACGTCGCCGGTTTGGCCATGAGAAGCCCCTGGAACACATTTGCAACGTGGCGAATGTTGAACTCGTAGTGAAAGTTGG
CTGCCGTCTTTCGAAACGCTGCTCCGACTTGTGTATGCAAACTGAGCGCGGCCTTGAGAATATTGGGTGTGAGTTTGCGGATATCTTCAGCAAAGTCGGC
AACATATCCTTCCAAGAATGTCGTATAGATTGCCTGAAGACTCAGTGGACTCAATTGAGCGAGTGCAAATGTTACAAAGTGCCGCTGCAGACGCGGGTTC
ACGAAGAAACTGCCGGCGCTCGGATTCATGCAGCTCAAAAACTGGACGTTCTGGATTTGCTTGACCGTATACTTCGTGCGGTCGTACCAGTGGCTATAGT
CCAAGTGCTGTCGCAACAGCGCAATGGCGGATTGAGTGTTGTACGCATCGAGCTGCGGGAGGTTGAGATCGTCAAGAAAGTAGACCAGCTGTGTACCAGC
GCTTGGACCAAACGTCGAGCCGACTTTTTTCGATAGTTTGGATTCCAAAATGGTCTGGAGCGATGCAGCACTGGTATAGTAATTGAAGTTGATGGCCATA
CTCTCGATCGGCTTGCTCCCACTAGTGTTAGAGTTGGCATTGACGCTCAATCCTGAGAGAAGACCTTGCACAAGCTGGGTCTTGCCCGTACCGGCGTTGC
CGCACAGCATGAACGGTCTCTGCTCACGAACCATGAGACTCATCCAGCTCGTGATCGACGCGGTCTCGGTCGTTGGCACTGTAATTGACGACATGGGCAC
GGACCCATCAAACTGGACAGTCTTGAAGAAAGGCGACGACCGCCACGAGTCGAAATTAAGCGTCGTCGGGTTCAGCCAGTAGTCAAACACGGAATCGCGC
GTCGGGATCTTAATATGCTTGAACTCGCTTCGCCACCACTCACTGAAGACCCGACGATAGTCTATGCCGTCGTCACTGATTGTCAGCGCAGCACCAAACG
CCCATACCGAGAGGAACCCGCTGAGCATGTCGATCTTCTTGGCATCGCGCATTGCCTCGGCATCCAGCACGGCATCCAAGTAGTACAGATAAGTCTGCAC
CATCGTGATTTGCTCGGTCGGTACGATGGTCTTGCACTGTGCAGTGATGAAGCCGACAATGGGTTCAACATACTTGTTCATGGTCTCACCTAGTGAAGAG
CGTTGTTCGCTGGTCGTGGCTTTGGTCATGACCCAACTCGCAAGCAGCGACTTCCATTGGAAGCCGTCCGTATTCGAAATGTACAGAATCCCGGCACGCG
ACACGGTCGCGGGCGTGGCATAGTGGAGATCTCGAATTTCAAATAGCATGCGCATGTTGGCCTTCAGCGGGATGCGCTCATTTGAGGCGAGCGTCAACAT
CTTGTTGTCATCCATGACCGAGTTCATCGACTCGATCCAGTTGGCGTCCAGATCGCCATCAAGCACGATCCACTTTGGCCGGCCCGCGGTCTCACCAGTG
GCTGACGCGAGGTCTCTCATGATTTTGGACAACAAGCCGTCTTTCCACTCGCGCGTACCCAAGACCATATAGCCATAGAGCTCTTCCGTTGAGACAGCCT
TAGGGTTGAGATCGACGACTTTGGTGACGTACTCGTCACCTTTTTTCTTGCGCGCGGCCATCAACGCGTCGCGACACTCAGTTTTGCCGCTGCCCGGAGA
GCCCATGATGAACACACAGTGGCGAATCGCCACGAGCTCTTCAAGTTGCACGACCTTGAGCCGGAACTGTTCGTGTGGCCACAGCACGAGCTCTACGCAC
GCCACGTGGACGTACTTTTCCATGGCCTCATCAACTTTGCGAGGTGGGTCGAGTTGAGGAAAGAGATCGCTGAGTAGCCCCTTAAACACGAGTAGGTCCT
GCTCGACGATCTTGGGCAAATTGAAATCACGAAGTGCCCGCATCAAGACCTCATGTTCCGAAAGCTTGGGCTCGGCCCGCTTGAACGACCCGGCGACGAC
CAACACGCTCTTGACTGCGCGTAATCCCCAATCATAGTGCTCCTGCTTGGAAAGCAGCTCCTTCAGCAGCGAATAAAGACTGAAAAACTTGGAGGCCAGC
ACTTTGGCGTCCTTAAAGCCTTCCGCCATGAGCATGTTCTCGCAGATGAGGACCAAGTCTGGCGCCATGACTGTGATGGGTCGAAACAGCGCCTTGAGCC
CTTCTGGCAATTCTGAGCGGCCAAGATAGCCGGGGTTCATGGTGATAAACGTGCCACACGTCGGATCCAGCTTGACTTTGTCACCTTCGATCGTCACGTG
TTCGTTGTCGCCACGAATCGCATCGCATACGGCCTTGAACTGCACGGAAC