Description :
From Genome Similarity Track
Location :
Scaffold_501:1- 4746
Sequence
4745 bases(100 bases per row)
ATTGCTGTTCTCGTCGTGAGATTAAATATATGTTCTTTTAAGAACATGTACATGGGGAAATGGTTGGTTTACCCGTCACGTTTTGATCCCGGAGCTGTAG
AGACACACTGGCGACACATAAAAACACTCACGCCAATCAGCGTCCACTTATTCATTCTGACGTACCACGGATACTGGGTCGTCTTCGACTTGCTGGGAAC
ACCAGTGGTATAAAACGCTGGTGATGGTACCGGTGCTAATTGCCATGATAAGGGAGAACTGTGGCCCGCGTGATTCAAGGGCGTGGCCCCTGCGGGGCCA
CACCCATGAATATCGCGCGTACCGCAGTTCACTTTATGAAGCTGGTGCATGGGTCTGTTGACGTGCATTTCCTGCCTCAGTCTGCCTTGCTGAAAGCTGC
CGTTGAACCTGCTCGGTCGACATCCTTCTGGCTTGTGTAGCACGAAGGTCGCGCCAGGTTACGCTTACGCGTCTAATTAATCCGTTGGGAGCTGTCCACC
CCCTCATTCTTCGGGAGTTCCCAGTATAATCCTATTTGGTCTGCGATAGCAGCACTAACGTTGCTTCCTATCCCAGTATAATTTTGTGGACTACATTAAA
CCCTAATGGCGATAGTACGGTGGAACAGAGAAGCAAGAGTTCGTGACTACGTACAGTCCGGGATTTTCAAAACATTCATAAATTGTGCCTTTAGCTGTTT
TACACGTCCGATTTACCAAAACAACTGAAAAGCACAATAGAAGCGAACATTAAACAAATTATTGATTTGTATAGAAAGAGGCACATGAAATTTAGAATTA
CTAAATATTAATAATACGAAGGGCACATATAATCACTAAATTGATATTTTACTACTTAGTAGCCGCAGTCATCTGCACATTTAGCTGGTTAGTTTAACTT
TAATAAATGAAAATTAGAAAATGAGACTCTTAAGTTAAAAAAGGTAAACATATTTTCTTAACTATTTTAATAATTTAATTAATTTATTAAACCAATAGAT
ATATGTTGAGCGTTAAGACGAAATAAATTGCTCAGTCCACTACTTTTTAAACTTATTTATAGTAAATATGTTTATTAGTATTGTCGTTACGAAATAAATG
GCTAAACCAAAAAATAAATGTGATATAATTATTAAAAATTATATCATATCCACCACATTATTAGAAATATACGACATATATTTTTATGATTAGAATAAAT
TGATTATCTAATATCAAGTAGAGGCTTGAAAAGCAATGGAATTTGATCTCAGTTGTCAGTTGTTGACAACAATGCTTCCATGCAACCATTGCTTGTGTTC
AATGCGTTTTTTTCTCGGTATTCCAAACATTTTATAATGGCATCCCGTCCTATCCGCGAGTGCCTTATGAAATTAGGACGACGTTTAAGTCTAATCCAGT
ACTGAAGGAGTCTAAATCTTTGAATCTCCATAGCTGCTATTTTAGTACATGTCTGTTGAAATGATGGTAACGTATTGTGAAAACCGCTTCATTTGCCTAT
TTTGCTCGTAAATCGATTGATTAGCACTATGATTTTGCTCGATCGATTTGTAAATCGATCGCGCCCTGCGATGCATATGCGAGTGGATGAGCAGATTAGG
CGATCGTTTTATGGAAGCCAAGTGATATAGCCACGCTTGGAGCAGAATGCCCACCTTTTACTGGGCAAGTGCATGAAGATCACGATCGATTTCATCCCTG
ATTTGTACTCTGATTAATTAGGAAGATGAGATCTAATAAGGGGTTGTTACAGATGGGCGTTTTAGCCGATTCTCACAATAACAGTAGTATTTAAAAAAAC
CGTCACCAGGAATGACCCAGTATGGTTCCCGACTGTGCACAAGATCCGCATCAACTTTGCCTACCTGTATGTAGGTAGGTACCTGTTGCAGTGCGACCCG
CGAACTGTGCGTAGCTATTTGACGCAATTGCGATGCACCGATGAACCGTGCGTAGATACTTGTGCAACTGCGACAGTCCGGAGGCGGCTGCTACAATAGC
GCGCAGCTTGACGACCTGAACATTTCACGGTCACTGAACTATGCGTACCAAACCAGTACGTAGGCAGACCGCGTCAGCGAAATGATCAGTTCAGTGAGCT
GATATCAGCTCACTGAACTGTGCGTAGGTACCAGTGCACAGGCACTGTAAACGTGAATGTACACGTTCAACACAGAAATAAAATGCCTGCACACTAGGGA
CTTCGAATCGATCATAGAAATCTGCACTTTAGGTAAGTGATCAAGGATTAAGGGATCGAGGAATACATCGTGTCGTGTGGTGTGTGTGTGTGTTGGGCTA
GCATGCTGTGAGTTTTAGTCAAAACTTTACTTCGCGGTGTACTTATAACTAATTAGCTATCGATCAGCCAGCCAATCAGCCAGCCATCACTGCACTTGAA
GTCTTACTGATGGTTGGTCGTGACGCTGTTAAGGCAGCAACTGATTGGTATTCGGTGTCACGCTGGCCCCGCCCCGAGTTGTGCTGAGTACTGCGAATGA
ATCGATTGTCTCTGGTGCTGAGCTGACATCAAGACTTGAAAGCAACGGATCGCGACGGGATTAACATGTTTGTCGTTCAAGAGGTCCACGCATGGGTCAC
AGCACTCACAACACAATTTGCTGCGGAAGAAAGTATCAATAAAAACAGTATTTCCATAGCCATGGTCGGCCCCGACCGGTGTCCGCAGATCAAACTCTCC
TCCGAAGATTGCGCGCTGTACGACAAGGTCGCCGTAAAGCTCGTGTGGAACACATTGTCAGAGTCCGCTAAGTTCAACGCCGATCCACAGCACTGGATCT
TCGTAAAGCGGCGCAACCATGTCAGCATCTTCAGCAGTGTGCCTAGTTCAGCGAACGAGTCGGCCATCACCATGGTGGGCGCGGGTCTCATTGACTGGAG
GACGTCATGGAAGGGCTTATTGCGATACGACCCACGAGCTCCGCATTGCTAACGTGTTGCTGGGCAACAGTAAGCAATAGGGTTCTTGTACACAGTACTC
GCTCCTGGTCGTATAGCTCGTAGGTCGTGTCCGCTTCACAAAGCACCAAAACGTCAACATCAACTGGCAGCAAAGCACTCAACTTACGTCCTCGCGCCGG
AACCGCTCGCGCAGCTCCTACTTATATTACTGGTCTTGATCTACTTGGTCGCTAGCTGCTGCTTGGTCGTCACGTCCACCTTGTTCTTGTCGTGGTCGCT
GCCCTTGTCCTTGTCCTTGTCCTTGTCCTGCTGACGTATAACAGGGTTACACACACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACATCTGT
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCCGATCGACGAGGCGACCACGTTCATGAAGGGGCTGAGAGATTGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTC
GAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATATGCCGAGGCCACAGCCACGCCCGGTAGTGAGGA
CGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGG
TCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCCGGCACCGTCGCAACCAAACAAAAAATGCTGGACGCCAG
TAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACC