Description :
From Genome Similarity Track
Location :
scaffold_219:1- 4697
Transcript NameFunction/comments
g5849.t1hypothetical protein

Sequence
4696 bases(100 bases per row)
GTACAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGCGAACAGGTGCAAGCGATCGACGACTTCTTTG
AAAGTCGTCGTCTTGCAGGTCAAGTGCGGGAATCAAAGTCTCCGCACAGTGCCCCGACGTTCTGTGTCACGTAGCCACAGGGCGGCTGGCGCATCGTTCA
TGCGTACAACAAGTTGAACGATGCGACGATACTGGCGCAGACGCCGATACCGCGAAAAGATGTGATCATCGATTCGATGGCCTTGAGCACTATCTTCAGT
GCTCTAGATCTACGTGATGGATTCTTTCAAATCCTCATGCGTGAGAGGGATATACCTCTCACGGCGGTAAGCACTCCAAGCGGTATGCTTTGGGAGTGGC
TCGTCATGCCGCAGGGACTTAAGAATGCCCCTGCGACGTTCAATAGATGCGTGACATATCTATTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGA
CGACGTGTTCGTCCACAGCCGGGCTGTGAATGGTAAGACGGACGTTGAGATGCACAGGGTGCATCTCCGGAAGTTGCTAGAGCTTATGAGGAAACATAAG
CTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGAGCGAGATACCCGTGCTGGGGTGTCTCGTCGGGAAGGACGGCGGTCGCCCTGGCCCAGAGAAGG
TCAGAGTGATCAATGAATGGCCCACGCCATCCAATGTGAAGGAACTGAGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGGAGAACTACGC
GGGCAAGATTCGCCCGCTGTCGCAGCTTCTTAAGAAAGAATCTGAGTTGAGTTGGACCACCGAGTGCCAAGGGGCATTCGATGCAGTCAAGCAGGGCTTG
ACTGAGGCGCCGATCTTGGCAGTGGCTGACCAAGATCGTCCATTCCACGTAGTGTGTGACGCATCCGACTTTGCAATCGGATGCGCGTTGATGCAGCACT
ATCACGAGGGGCGTGATACGTTGAAGCCAGTTGAGCGTAACTATCCCGTACATGACAAGGAGTTCCTTGCCATGAAGTATGCACTCGCAAAGTTCCGAGT
GTATCTACTAGGGAGTAGACCGTTCGTGGTTTACACCGACCACGCATCACTGCGGACGGCGATTAAGTCGCCGCACATCTCGCAACGTATGGCGAGATGG
TTGTCCTTCTTCGCGGAGTACAACTTCCGGGTTGGGTACAAACCCGGAAGACTCAACGTAGTGGCCGACGCGTTATCGCGTCGACCTGACTATGCGGAGA
TGGTCGACGTCAACAGCGTTGACGTCGTGAGGACAAGTGTTCCGTCGTCAACGTTACTTGACGACGTGAAGGGCACGTATGCAAGAGATGCAGACGCGAA
GGGACTGCTGGAGTACCTCGCAGCACCTTCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCCTTGGACTTTGTCTTCGGTCTTCCGCCTGACAGCAAGCG
GAGGACGGGCATCGTTGTCTTTGTGGACCGATTCAGCAAGATGGTCCATCTTGCTGCCGTCCTGGCTACTGTTACAGCCGCGCAGACTGCGCGACTGTTT
GTTGACGTGGTGTTCAAACACCATCGCATGCCGCTCGACATTGTGTCGGACCGTGATACACGCTTCACAGCGCGGTTCTGGCAAGAAGTGTTTACACTTC
TAGGTTCACAGTTGTCAATGTTGACTGCGGATCATCTGCAGACGAACGGACAGACCGAACGCGTCAACCGTGTACTGGGTGACGCGCTGATGAGCTACGC
TCACTGGTTCCCGCATTGGAGCGAGTGCTTACCGATGGCAGAGTTTGCCATCAACAACTCGGTGCATGTCTCGACTGGGCATACACCGTTCTACGTAAAC
GCCATGAGGCATCCACGTTTGCCGAGCATGCTCGGCGGGGTAGCTTCCTCCTTAAGTGGGGGAGGATCTACGGTTGCGTCTGAACAACCGCAGAATACAG
CTGATAGCACACTATCAGCTGCGGTGACGCGTGCAGCGTCTCGTTCGAGTAGGAACGGACGCGCGATGTCTGTGCCGGGCACAGACATAGGAGATGAAAG
CGCGCAGGCAGGGCCTGCTGCGGACGAAGACGACGAGCTGAAAGGATTCAGCTCGAACGCGCTAGACTTTGTCCAGCGAAGACAAGCCGTAATACGGCTT
GTGCAAGACGCTATTGCAGCTTCTGTCGATCGACAGAAGCTGAACGATGATAATGTTGGTAGGGGCAACATGGATGAATTCAAAAAGGGTTCATTGTTTT
TGTTAGCTACTCAAAACCTGCCTAAACATGCAGTGTCTGACTTTGGAGCAAGTAAGCTTGCTCCAAGATTCATTGGGCCGTTCACAGTACTTGAACGGCA
CGGCAACGCGTACCGGCTGGACATACCGTTCAGCATAAGGCTCCATCCGACGTTCTACGTCGGGCGGTTGAAGCCGTACGTGCAGCACGAGTCATCTAGG
GTTGATGACTCGCCTGGGAGGCCTGGAAGGCCTCCTCGATCTCGCGGAGACGCTCGACATACAAGTTCAGCCTCGACCTGAAGCTGGACGAGAGGTTTGA
GGCCGTCTGAGCCGCCTCAGCGGCGTCAGCACGAAGGTTCCTCACCTCTTGACGCAGAGACGCTATCTCAGCGCTCTGGGAGTGCTCAAGAGTAGCAACC
CGATCGTGCAGGGCACGATCGTGATGGTCATAGCGTTGACCATACGCAGGGAGTGTTCCCACCCCCTCCGCCGCCGTTGCGCGACGCGAGAGGAGCTATC
CGCTGGATAGTTGAGCGGATCGTGGATCATACGACGACGACCAATCAAAGTCGTCATTTTCGAATTCGTTGGAGAGGATTTCCTCCCCATCGAAATGCAT
GGGAACCACGGAACGCCCTAATGGAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCCCGCCATAACTTGCAGGGTTAAGCCCTGCACGAGGAGTGCTG
CGGTCAGCCACAGCACTCGGAGCTTCGCGTGGCTCAATACGAGTACGGAGCTCCTTGATGTGATCGGGTACACGCACCGACGTGTACCCCGTAAGATCAC
TTTCAGAGAGGCGTGCTGCCAACGGCAGGCAGCACGGGCAGCTCGTGCCAAAGGGCACAGCGCAGGGAATTCCCGCTTCCATGCATAGGCCATGGAGACG
TTCACACCTACCGCGAACGGTGTAGGTGTAGTAGCGTTCGCGAGCATTGTCAACACGCTCGCGATAGGCTTTCGGAGCCTTGTTGAAGTTTTCAACAAAG
GCGTTCCACGACTGACAAAGTGCCTGCCACTCTGGCACTTTGCTCTTGCGCGAAGTCTTCTTCGCGCTGAAGTATCGGAGCTCATGGAAGAGTCCGATGT
AATAGTTGCGTCTCTGAGTTGGGGACTCAAAGACCGTGTTCTTGGCGACTTCGTCGTCAATGATCCTGTTGTCGTGATACAACAGGATCGGGTTCGGTGG
GCAACTAGCACCGAACCGCTCCTGGATCTCAGCCTCGGAAGTGCGCGCACTGGCGGAGGATCAGTGCGCGGAGAGATGAGCGCCCTCGACATCGGGGACG
CTTCATCGTCGCTACGCAGACGCTTCGAACTAGAAGCGCGCGGAGCCTCTTCACGGGGATGTCTAGACCCCAAGGGTGGGTCATGCGTGTCTTCAGAAGA
AGACAGGGGGGAGGGGCTTTGTCTTCAAGCTCGCCCTCTTCAGGATCTTCCTCATAATCGATGAGATCCTCCTCGTCCCCAAAGAGCTATTTGGGGTCGA
CAGCGTAGCTGGGCTTCGCTGCATCCTTCTCCTTCTGGAGAGCATAGTATTGACCGAGAGAGAGGTTACCCTCTCTCGTATGGCTGGAAGCAGCAGTGCT
AGCAGGCACTGCCGCTGTTGTTCCTGCCGCAGTGGCGGCAGGAGAGGCTTGCGCGTCTGCGGCTGCGGACGAGGACGTTGGCGTTGGCGTTGGCGTTGGC
GTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGTTGGCGAGTTCATCTTGGAATGAACTCGGGTTTCTCTCT
GGGACTTGACGGTCTGGTCAAGTTCTGTCGATTGACGTATCGGGACCGATACGTCGAATCTTAACGGGGGGATAGTGTAACGGGGTTACACGTCAAGTGG
CAGTAACCACTTGTAAGTCTAACAGTTAACTGTTAGAGGTTGGAAAGGAACCTCCAGCATTGGAGTGTGGGCACACCAATAGCTACATGGGCAACCAACC
TCGATGGTTGGCTCGCATGCATTTACGCATGTTATTGGTAGAAACTTATGGATTTCTACCAATCAGTGCGTGACACAAGGGTAGGGGTTCTGCCAACCAC
ACGTTGACTGACCCTTTTGAAATAGATAAACAGATTTAGGAGGTTCGATAATTGGCTTTTGCCATATTCAATAACAGTTCTCATTTTACGGTATTTTGCA
GTTTAATTGCTTATATTTGGTTTATTTATACTTACTGAAGTAAGTATAATTAAATTAAGTCTAAACTAATTGCACGCTTCCTCATACACGTAAGCGCACG
TGCACGCCACCTAGTGGGTCTCAGTAGACCCATTACACCATTCATCATCCGACGTTTTCTTGACGGGCGGGCTCTTTGGGAGCGCTTTCCTTCGGG