Description :
From Genome Similarity Track
Location :
Scaffold_2584:1- 4641
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2584-fgenesh-gene-0.0O-phosphoseryl-tRNA(Sec) selenium transferase
Pytiw_DAOMBR242034maker-piw_contig_2584-fgenesh-gene-0.1Eukaryotic translation initiation factor 3 subunit

Sequence
4639 bases(100 bases per row)
CGCGAGGCGCGCGTGTTCTCGTCGCTGGTGGCGCGGCGCCACTTCCACCTCTGTCACGGAGTCGGCCGCTCGGGCGACGTCGCCGCAGTGCAACCCAAGG
CCGCGGGCTCGTCGCTCATCGTGCAGCTCGCGAACGCGCTCGCCAAGGACATCCTGAGGGAGGCCGGCATGCGCAGCGTGGCCAGCGCGCTCGTGCTGCC
CGTGGCCACAGGCATGTCGCTCACGCTCGTGCTGCTCACGCTGCGCGAGCACAAGCCGCTCGCTAAGTACGTGCTCTGGCCGCGCATCGACCAAAAGTCG
TGCTTCAAGTCGATTCTCTCGGCCGGCCTCACGCCGCTCGTCATCGAAAACGAATTGCTCGATGGCGGCCAGCTGCGCACCGACATGGCCGCAATGCAAG
CACTCGTGGACCAACACGGCAGCGACAGCATATTGTGCGTACTCAGCACCACGAGCTGCTTTGCACCCCGCGGCTTTGATAAGGTGGACGAGATCGCGCG
GCTCTGTCAAGCGCACGAGATCGGACACGTGATCAACAATGCCTACGGCGTGCAGTCGTCCAAGTGCATGCATCTCTTGAGCGAAGCCATGCGCACTGGC
CGCGTTGACGCCGTGGTGCAGAGTCTCGACAAGAACTTCTTGGTGCCCGTCGGCGGCGCGATCGTGGCCTCGTCGTCCGCGGACTTCGTCGCGGGCGTCT
CGAAATTGTACCCGGGCCGCGCGAGCATCACGCCCACACTCGACTTTTTCATCACGATGCTGCAGATGGTACGCTATATATACCAGCAACTACTTGTGCG
CTGCTGTTGTGAGACGGACAGACTGACTTTGTTGTTGTTAGTGTAGGGCCGCAATGGCTACAAGCAGTTGCTCAAGGAGCGCAAGACGCTCGCCAAGTAC
CTCGAAACGCAACTCCAAGAAGTTTCACAAGAGTGTGGCGAACATGTGCTGCGCGTGCCCTTCAACGACGTGAGACCTATGCAATTGCTACGTCCAGTGC
AACTCAATTGCTTGCTAACTACATGCTTGTGTGCACATGCTTAGATCTCGTTTGCAATGACGCTCGGCAGCTTTTGCCCCGATACCTTGGACGCACAAGC
TAAATCCAGGGAACTCACGTTCTTTGGCGCGATGCTCTTCTCACGAGGCGTCTCCGGCACAAGGTACCTTCCTCAGCAAAGCAGCTCAAGCCACTCCCTA
TTTAGTATCTCACATCTCTTGGTGCGGTTGTATGAAAAACAGAGTCGTGTCGTGCCTGGACAGTAAGGCCATCGGCGGCTACGTCTTCGAGTCCTACGGC
GCGCACTTCAACCAGTTCCCCGCACCGTACCTGACGTTTGCGTGTGCGATCGGCATGACGAAGCACGAGATCGACCTGCTCATCAAGAAGCTGCGCAAGA
CGATCGCGGAGTGGAAGGCCAAGCACTCGAGCCACGCAAAGGAAGACTAATAACTGAGTTGTGATTGGAAATAACAAAAATGGTGGAAATTGGTTCCAAC
CAATTTCAACTTGTTTGTTTTGCTGGCGCTCGTGCCTCACGAACGAACGTCTATTGTTTTGCTGTCGTTGAATCATTGCGTGCTGTGTATTCCTACTTAC
CGTACATACAAACTCATGTCGGCCTGGGATCTCCTTCATCTCTTTTGTCCTATGTATCTTGCTTGAGGTCGCTTGCTCCCCCGTGTTTCTTCGCCTAGTG
CTTCTTGTTCTTGTTCTTCTTGTTCTTCTTCTTGGATGACGCCGGCTCCTCCTTGATCGTCAGCTCCGCGAGCAGCTGGTGCGCGATCGCGTCGGCAGCG
GCAGCAGGATCCGCTTCCGCGCGGCCCTTGAGGCCCTCGACTGCTCGCTCCGTGAACTTGGCCATGTACTTGGCCGACTCGAGCACGCGCGGATCGTCGT
CGCCAAAGGCTTCCTTGAAGAGCGAGTACACCTTCTTTTCGTAGGCAAGCGCCTCACGGAAGCCGCCCGCGAGGCCGCACGCCAGCGCCATCTGATGGAG
CGTGTTGGCCGCCTGGAGGCGGTCCAGCTCGCCGCGCTTGAGCGACTCGCGGTGGCACAGCAGCGCCAGCGTGATCTGACCCACGTCTTGGCACATCATG
CCCATCTTGAAGTACAGCGAGCTAATCTCTGGGTAGTGCGGTCCACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGGTAGACTGAGCGGCGCAGGTGGGCAACCGCGACGTCCGTCTGGCCGTTCGCGTGC
AGGAAGAGCGCCAGGTTGGCGTGCGCAAACGCCGTGTCGTGATAATCCATGCCCGAGAGTTGCGTGTACAGCGCAAGCGAGCGCTGCTGCTGCGCGATCG
CACCAGGAATGTCGCCCGCGTGGTAAAGCACAGTCGCCAACGACGTGCTGCAGAGCGCTGCATCCTCGTGAGCGGCGCCGCACACCTGGAACAGGAGCGC
CGACGTCTCTTGCAGCATCTCGTAGGCCGAAGCGAGTGCACCGCCGCTGAGGTGGAGACGGCCACGCTCCAGCAGCTGCTTGGCCTGCGGCAGCGGGTGC
GCTGGCAGACTGTGCTTCACCACTGGCACGACGCCCGTGATGTCCTCGATCGTGAATGGCTGCGTGGACGCAAAGTTGTAGTTGCGACTCACGACGCGGA
GACCGTTGCGCTGGCATAGACGGCGCAGCAGCACGGTCTTGTGCACGCGGCCGAGCGGCACTTCAGCGCTGTCCACCTCCTCTTCGCGGTTCCACAGCGT
CAGGTCGTAATCGAAGCGGTTCTTGATCTCCTTCTCGATCTTCTTCCAGGCCAGCTTCGCGTCCAAAGCCGCAGTGGGCGACGAAGCAACGACTGACGCG
TCAGCGGCTTCGTCATTCTTCTTGGCGCCGTTCTTGCCACCCTTCTTGGTCTTCGCCTTGCCGCTAAAGTCCTCGTCGCTCTTGACGCCCGAGGAACCAA
GCACTCCGTTCAAAAGCTGCACGAGCACGGCGCCAGGGGCCGCACGTGTGGCTTCGTCGGCGTTCAGAACATCCGCGAGCACGTGCTTGACAGCACGCGC
GATCATCTCAACCTCGAAGAGCTCCAGGACGTACTTGGAGATGCCACCGATGGACTCCAATTTCTTCGCGAGCGACGCCAAGCGGCCCAGGTAGCGCATG
TTGATGCCACATGAGTGCATCTGCTCCGTGAGCGCGAGTCCGTCCGCGGGCGAAATCGAGCCGCGACGGATGTCCGAGAGGAACGCCGGGATGACCACGC
TCTGCAGGTACGCCGCCGCGTCATTTGCGGCCTCTTCATCGGCCTTGGCCTCGGCCTCGTCAACCGAAGCCTTGTACTTCATAAACACGTTCGGGTTGAG
ACGCACCGCTAGAATGTCGCCAACATCGATCTCTTCGTCCTCGTCCTGCTTGGCGGCCGAAGCCTCGTTGTCCTCGGGCTTCTTCTCGACCTCCTTGGCA
GCCTTCAGCTCGTCACGCTTCGCCTTGCGCGCCTGATTCTGCTTCCAGAGCGAGTACAGCTGCACGAGCTCAGGACGCAGCAGCGCGACGTAGCCTTCGT
CTTCGCGGTTGAAGCGAAGGCCGTCCTCGTCAGCGGCCTGCTCAGCGCGCTCAGCGTAGTACGTCGCGTCCTTGGGCGTGATGCGCACAAGGTCGAGCAC
GTACATGCGGCCGTCGGATCCGAGGATGCCCTTGGCCTCCACTGGTCCGCAGAGCTTGACCACCTCCGTGGTAGCTTCGCCGCCAGCGTTCGTAGCGCTG
ATGATCTCCTCGTCAGCGTCAGCCTCGCCTTCCTCGGTATCCAAGCCAAGCGGCTTAATGCTGCGCTCAGCGATGTGGAGCTTCTCGCCGGCTTCGAGCA
TCAGCGCGTGCATCTTCTCGTTCGACGCAATCGTCTTGCCGGCGTCCACCGAGCCGTACACGAGCTTCGAGGCGGCCTCGCCCTGCAGGATGCCTGGGAT
CACGCTCTGCGCGATCACACGCACGCCCAGGTAGTCCACCACGGCCGTCGCAAGCGTGTGCAGACCCGGGATGTCGGCGTCGTTAAACGCCTTGACGCCC
TGCAGGTCGCGGTTCGCCGACGAGTACGCGGCCTCCTCGCTCGCGGCGTCCTTGGCCGAGAACTTGCCATCGATCGAGAGCGAAAAGAAGATGTTGTTGA
ACACGTACACATGCGCGCTCACATCGTCCATCGGGTTGATGGGCGGGATGTGGCCCTCGACGATTGCCACGGCACCCTGGGTCGCCGACTCGACAAACTC
GCTTACGATCTTGTACATGACGCGCGCGCGCACGATCTGCTCCTTGAGCGTCGCGCTCGGCAGTTCGCGGCAGCACTGGTACTCCTCGTTCCAGTCACGC
AGCACGCCGCGCTCGTCCATGCCGTAGGACGCTGTGAGCTCGTCCTCGGCGCGGTTCAAGTCGTACTCGTGCTTGGCATTCTTAATCACGGGCGTGTTCC
ACGGCAGCTTGCCGCCGACGTTGTTGCCGGCCGCGACCA