Description :
From Genome Similarity Track
Location :
Scaffold_311:1- 4509
Transcript NameFunction/comments
g10038.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g10039.t1hypothetical protein

Sequence
4508 bases(100 bases per row)
TCTGCGTTGTCGTCGACTGCGCTGTAAAGAAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACT
TGTCAGAGGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCGCCCTTTACGTCATCCAACAAGGACGACGAGGGTGTAGT
CGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCAGCCACGACATTCAACCTTCCAGGTTTG
TACTCAACCTGGAAGTTGTATTCAGCAAAGCATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGT
CGATGTAGACCACGAACGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATT
GCGCTCAGCTGGTTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATAGGAT
GCATCGCACACCACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAAT
CAGCAGTCCATTCCCATGTAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAG
TCCAAGGAACTGCCGCAGTTCCTTGACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACG
AGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTTAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGAT
GCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCATCGAAATAGCTCGGTGCAAAGTTGCGCACCAAGCGCAC
CAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCC
GTGAGAAGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCA
CATCTTTTCGTGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCATCCGCCCTGTGGTTTCTTCACACA
GAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTTCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGC
AGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGCAACTCCGCAGGAATGTCGTCCG
GGAGTACATCCCTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCT
GAGGGCGCCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCA
TCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTGACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATT
GGAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCTTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCC
TGACCGAGACTTGCGCAGCTTTGCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCCTGTCCAGGCCCGGCCGTGGACAGT
TGTTCTTTGAATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGC
TCGCAAGCATCTCCGGTGCAGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGC
GGAGTGTCTTTCGACCAATTGTGTGTCGACATTATCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCC
TGCTGGTTCGATTCACATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCGTTCCGCGCTGTCTCTAGTGGAG
GGCCGCATGCACCACGCGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCATCCA
GTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTC
TCTTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCTACCT
CCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTTGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTAC
CTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATCGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACA
CGCTCGACCGCATCACCAGCAGGGCACCCCGCGCCTGCTGATCCGTCTAGTTTTTTGTTAGCCCGTGCCGATACCCAATATCGCCACGACGGCTCTTCGC
CACGTGCTCAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTGTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCA
GCCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACCGGTCGTGGCATCAGCCGCAGGGCGTTCACATGCAGTTTAGCCAGCCGCAGGCTAAAC
TCTTCTTGCATTGCGAGCGCATTTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGTCTTTCATGAACG
TGACGACCTTTGTCGTCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTG
CAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGCTTGAGCTCCTCCTTGAACTCTTCGTACGTGTTGAAGCACGTA
GGGTCCGCGAGTCGGCGTCCGTACGCCCAACTCCTCGCTTCTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAG
CCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGACTCTCCCTCTCTTCCAACGTAGTTGCTTACGTGGAGCTTCAATGACTCCACGCGCGG
TGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTT
CGCAACATCGTTACTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAA
CATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGCTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGT
CGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGGTTAGACCCACTACTTAAGCTTGCACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGT
AATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAAAGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATT
GAAAAAGGGGGTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTTATTGGTAGA
AAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATTCCTTAGTGCATGTTGCACTAAGGT
GGGAGGTG