Description :
From Genome Similarity Track
Location :
Scaffold_1511:1- 4432
Sequence
4430 bases(100 bases per row)
GAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCC
AGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCGGATTTGCTGCGCAGCTTCCAGACCCAGTACTGTGGAATGGGAGTGTCG
GTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGCTGAAGA
TCAAGAATGGGGGATCCAAGGTACTGCGGGAACATGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCT
TCCAGACGCAGATGAGCTCGAAGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAG
GCTCCGACACCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAGTCAGGATCCGACGGTTCGGACTCCGACCCTGAAG
ATTACCGTCGAGTCTGTCTCACTGCGCCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGTA
CAGATCCCGACATCTCATGGACGGGACAGCCCAGATCAGGTGTGGATCCCGAAGGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGT
GGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACC
AGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTA
CGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATC
TACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAATTCTCTTCAACCCTGGATCTACACAGAGAAGAGGC
ACGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCC
TATGGATCTGAGGATGTTGGATCCATGAATCTGCTAACAGGAGAGTCCCGTGGGTACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGG
TAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTTTTCATCCTAGATAGTGGCGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTG
ATTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGG
TTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGAT
CTGGCGGATGGGACACTTGGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAAAGCGGATA
AGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAAAGACTGTGGGTCACTCGGGGCGAGAAATGGGT
ACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGA
TGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCG
AGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGA
TCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTG
CAGAGGGCGAAAGCCGAGCAGCCGGATCTCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACAC
TAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGA
AGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCTAATGGTGGATCCTACGAAGACAGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTA
CACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGA
ATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGTCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGT
CAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGC
CTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTAAGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTG
ATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAACGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTC
TCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGG
ATGCCGTTCGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGGTGGG
TCTGGGGAAGGCCATACGGAAGTGATCCATTCGAAGCGGGGGAGCCAGGAGATCCTGGGGACCCCATCTGTGTTAGGACGCAGACCTTACATCGACGCCA
TTCTGATTCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAG
CTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCC
TTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCACTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACG
AATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCTCTGGCACAGGAGATGCTGGATCCACGAAGGGATCC
AAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAACTGGATTCACTCCGGGACCAACAGAGAGAGGATCCAAGCTGGATAGAGACGACGGATCAGAAC
ATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGG
AACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACCTTCGTCAG
CCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTAGATCTGAATTACAACCTGCTAGTGGGA
AGACCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGCTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGC
CTTGGACGCTGGAGATTGTGAAGTGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCT
GACTAGGATCGACCTAAGAAAAAGCCCAAA