Description :
From Genome Similarity Track
Location :
Scaffold_1510:1- 4414
Sequence
4413 bases(100 bases per row)
CCTTCCAAGTAAAGGGAACGTCACTCTTCTCGCACAAACTGATTCACCACGATTTCCCGCCGGGAATCAGAAATGTCGTCGATGTAAAGATTCTGCGTCC
TTAACACAGATGGGGTCCCCAGGAATCCCCCTGGCTCCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCCAGACCCACCTGTTTCGGACTCC
GGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGT
GATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCT
TCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCT
TCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCG
GAACTGAGGTGTCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTA
CCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTCGATATCATCAA
TCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCAGGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTG
TTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTA
TCAGGGAAACCACCAGTTGGATTCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGGTTGACTAGTGTTGCCACTCTCGATAGGGATTCAGGCA
CTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATC
TAAGGGCCGACTCTGGGGATCGTCCCCTGTCCTGGATCCAACTTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGCTGGA
TATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGGGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCC
ATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAA
TAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGG
CTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGCTTCCCCGGGCTCGATCCAGGTGGTCTTATCCACCCTTATGATCCTCATCTTCGCTC
CATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCATCAGGGAAACAAAGTGTCCCATCCGCCAGATCCACCCGGCCGGCACCATGAAATCCATC
CCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAGCAGCCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCG
TACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACAC
CTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGCTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTGCTTCCAG
TATCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTTGATCTGCAGTGACTT
CACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCAAATAACCACGTGCCTCTCCTCTGTGTAGATCCAAGGTTGAAGAGACTTCGGATCT
GGAAAACGCATCCACTTGGCACAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATATAGGGTCCTGCTACCTGGA
TCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACTTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTCGTTTAACATCTTCTC
GGCCACCTCTGGCAACATCCCCCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCTTCGGACACTTGCCGACGTCGTGAATC
TCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGT
GCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATTCCACGGCCCCCGGGTACGGTATCCCCCGA
TCGAGAGTTATCTCCGGTCTTCGCCGTTCAGTCGTTGGATGCAGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCGAACCGTCGGATCCTGAT
TCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACATGTCGAGCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCT
TCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCCAGATTTG
CTTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAG
ACGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATCGTCGTGCCACCGACACTCCCAATCCAGAGTACTGGGTCTGGAAA
CTGCGCAACAAATTTGGCCACTTGTTCCTGGTGGATCTGCCCAACTGCCGATACCAGTTCCTGGCTGGCGACGCTAGCAGATCCGCAAAGGTCAGACACT
TCTCAGCATCCGACGCTTGATCTCTCATGAGGGCTGACTTGACTTTGCTGATCCATGTTTTCGCTCGGTCTTCATCTTGATCCTTGCCCGTGAACTCCTT
CAGATCCGATATGGCTCAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGACTGCGGCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCA
TCCAGATCATCTGGGTCGAACTCATCATGAGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCCCTTGCACTTGTG
GCACGGGCGCTTTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGTTGCAGGGTGCCCGAGAATGTGTCGGAAGAGCCTGTAGC
CGTCTGGTCCACTGGCGAGACCGGATCGGTTAGGCGATTACCTTGAACCCGATCTGACGATAATCGCACTGGCTTCTTGCTGGATCTGGCTCGATCCTGG
TTGGATTGTATCCGATCACGGGTAGGGCGTTCTGGATCCCGAGTCTTCACACTCGAGGGCGCTTCCTGTCCCCGGATCCTCGCCCGCGCTTCCAGCATGG
ATGCCCGGAAGGTCCCAAAATACATGGCTTCGGGACTGGGGAGGGACTCTTCTGAAACCTTTCCGCAACCCGCGGATTTCGTATTTTGGAGGAACGCAGT
TGTGTTTTTATCCTTCGGCGACGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATGGACTTAACTCTGACGAAGAGGTCCCGCGTCGCGGATACT
ATGAGATCCAAGTCTATCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGAATCCGTAAGCAAACGTAATAGATATTTGACTGCCACCA
GCTTGTTTGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGGCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCAGAAAATC
GCGTAGAGCTTGG