Description :
From Genome Similarity Track
Location :
Scaffold_451:1- 4395
Transcript NameFunction/comments
Hyaar_Emoy2814147hypothetical protein
Hyaar_Emoy2814148hypothetical protein
Hyaar_Emoy2814149hypothetical protein
Hyaar_Emoy2900038HaRxL39

Sequence
4394 bases(100 bases per row)
GCGAATCATCGCAGTAATAATGATTAGCTTATAATTCGATCGCCTGTAGTTCTGGAGTCTTCTTGTTCTCTTTTCTTAGCACAGCAGCACTGTCTCCCAT
ATTTGCGACATAAAGCACCTTATGAATGAACAACGCGATAACGGGGCACGACTTAGCGTTGCAGTAGCCCTTCGACATGTGGATGCTGGTAATGAAAGCT
AAGAGCGAATGCTTTATTTCTATGTCAGTAAGAAAAAGTGCTCTTGACTATTTCATGGACCTCACTACTGAAGCTGTCAGAGGTAATATCATTAAGTGTA
TCCTGACAAAGTGATGAACAGAGGTGACTGCACAAAGTACATTGACCCTTTTTAGTACACATTATCGCAGGGCAAATAGTTTGCGTCCACTTACTCTACT
GCTCTCGAGCCGCCGTGCCCGTCGAAACCGCGTTGATCTGAATACCAGCATCCGTCGTCTATACAACGTTCACGCTATGGTCTTCGCTCGGCCTGTTGGT
TTCGATCGAGAAGATGCTCGGCACAGCAGTACATTGTCTCATCATCGGCCATACATCATACCTGGTGTTCAGACGTGCAATGGCCTAAAACTAACATGAG
CTGGAGTATCTGTATCAATATCCGCAATATGTTGACACTTCCTCGCTACTTGTCCGTTGCCAACACCACACCTATCTGACCCTCTGCTGAAGCCAACGTC
CGACAGCAACGACGGTCGCAGCTTCACACTACGACTCACGTCCCACAAGCAACAATAGGTCACTGGTGCCAAGGTTAAGCAGTTCAATACATTAGTTTCT
ACTCGACGCCATACCCACGCAACAATAGGTCACTTGTGCCAAGGTTAAGCAGTTCAATACATTAGTTTCTACTCGACGCCATACCCACGCCTGCGACATT
CCAGCCCAACCTCGAAAGTGCTTCTCTCGTCGCCAAAATGCTTTTCACGCAAGACTAAACTCTATGATTAATTGTGTGTGTCATGACGCATGACGATTAC
CTCATGCAGACACAACGACATTTGTGTTTCGCCGATGAGTGAGATCGCAGAGCACGACTCCAAAGCACTATTTTTGTACGATTGTGTACCGCAGGATACA
AGAGGAGAGATAGTCTATTGAAGGAGAGTTTGGACCGTCCCGTAGGACATGGACGTCTGAGTTATTCGCCTTGGCTATGCGAGTACACAGAGGCGCAGAA
ACAATGGTTCAGGGGGCTCAGCTACATGCCTGCCTTGAACGTTATACTTTAGATGTATTTTGTTTTTTTGAAGTGACGAACCACTACCTATAGAAAGGTG
CCACGAACCACCGCCGCGTCAGGCGCTGGATTCCTGGCTTAGACGATTCAGACTTCTAACGCGTGATAATAATGGGTAATAGACAGTCATGAATCTCTCA
AAACGGACATCTGACTCCTGACAGTTGTTCTTCCCATCCTCACGACCGACCAGATGACATTCTCGCGCGGGATGCCTCGATGAAAGGCAGGTCTAAACAT
CCTCCTCCGATAGACTACCTCCTCTCTCTTGTATCCTCCACACAACTGTACATAAATGGTGCTTTTGAGTCGTGCTCTGCGATCTCACTCATCGGCCAAA
CACAAAACACACTGTACTTGCGTGAGGGTCATTGTCATGTGTCATGATACAGCTTTAACGATAGAGTTTAGCGCTGCGTGTAAAGCATTTTGGCGGCGGG
AGAAGCACTGTCGAAGTTAGGATGTAATATCGTAGGCATGATTTTGTCGTCGCATAGAATACAAATGTATTGAACACAAGTGACCAATTGACGCTTGTGG
GACGTGGTCGTGGTATGTAGCTGCGACTGTGACTGCTGTCGGCTTCGGCCTTAAAACTGGGTCAGATAGCTGTGGTGTTGGCAGCAGACAAGTAGCGAGA
AAGCGTCAATGAGTTGCGGGTATTGATACAGATACTCCAAATCGTGTCGTATCGAGTCATTGCACATCTAAGTTCCAGGTATGGTGGTATGGCCGCGAAT
GAGACACAAACGACTGCTGTGCTGAGCATGTTTTCGGTCCAGACCAACAGTCAGAGTGAAGACCATAGCCTGAACGTTGTATGGATGAAGGATGCTGATA
TCCAAATCAACGCAGTTTTCGACGGGCACGGGGGCTCGAGAGCAGTAGAGTAAATGGACGCAAACTATTTGCCCCTGCGATAACGTGTACTAAAACTGGT
TAATGTACTTTATGCAGTCACCTCTGCTCATCACTTTGTCAGGATACACGTGATGATATTACCTCTGACAGCTTCAGTAGTAAGGTCCATGCAATAATCG
ATAGCGCTTTTTCTCGCTCAGACAAAGAAGTAAAGTAGTAGCTCTTATCTTTTGCTCCCAGCATCCGCAGGTCGAAAAGATACTACAACGCAAAGTCGTG
CGCCGTCATCCCTTTGTTCATTCACAAGGTGCGTTATGTCGCAAATGGAGACTGTGCTAGGAATCTGTACGAGACCAACCTGTTGACAGAGCGCTCGCAC
GATCGCGAAAAAAATGATAAAATTTATCATGAATGGTGTATCGTGATGCATGGCGATTACCTCACGCAGACACAATGTTTTTTGTGTCTGGACGATGAGC
GGTATCACAGAGCATGACTCAAAAGCACTTTAAATGTACAATTGTGTACTGGAAAATACGAGAGAGGAGTGGTTATTATCGAAGGAGGATGTTTAGACCA
GCCCCTCGATGAGATGTATAGTGCTGCTTTCCCTGTTCTCTCAGAGACTACAAACTTTTTTTCCTACAGAACTTCAGTTATAGCCGGTTTTTTAGCCAGC
CTCTGAGGCATTTTACCGTTTTTCAGCGGATTCTGATCACGGTCAAATAGCCTTTTTGTGTAATCAGACGGTCCAGTATAGTCTCTATTTGATTCCTGGT
TGCATTAATCTGCAAGTTTGTATGATTTAGCAAATTTTGGTGGACTGGTCCAGCCGTGTCCCGTGGCGGACCAGGTCTCTCCCGCCGTGTCCCGTGGCGA
CCAGACTCGCCTTCTCTCGAGGTTTCAAGTCAACGTCAGTATCAAATTCACTCGGTGTGCGCCAAACCAATTTGGACCCCGTTCATCTCCACCCACCGAG
AACGAGTTGTGGCCTCCACTATGACCAAGTGCTCCCTACTTCTCGTGCCCTTCCTCGTCGCAATTGCTGTCAGTGACGCTCTGCCAGCTCGCGCAGCCGG
CACGCTGCCACAAAGCGCAACATCGGTCCAAGACAAGGCTACTGAGTCGACCGTGAGCGGCAAACGGGCGCTTCAATCAAAGGAAGACACGAAGGGTGCG
GCTGATGAAGAAAGAGCGCCAAATTGGCTTCAGTCGGTACCGGAGTGGTTGAGCACCATGATGAAGAAGACCACTAACTGGACGGCTCGCACGTGGAAAG
GAACTGCTTTTAGCATGTCGAGGGTGCCGCCGAAAGACATGGTGGAGGCGAAGGCTGTCTTGACGGAAATGGAGATTGTACGTCACCATCGCTCGATGGG
GTACCGATTCCTTTTATTTCTGAAGGCGGCTTGGGAGGCGGCTTGGGAGGCGGCTTGGAAGGCGGCTTCGAAGGCGAGTGAATTGACTAGCGTGCTGCGG
AGACGTCAGTCGCATAGACCTAACTTGCGAAAGCTGCACGAGGAAATCTATCAGATCTGGCTGGCCGCATTCGAGAGTGCATTCACAGTGAAAGAGCTGA
AAAAGGAGGTCGATAAGTTACATAAAAAGGTAATGGACTTCAGTGCGGCGATCGAGGCTAAGAAAGTGGCCCCTAGCGATTTCGTTAGACCGTCAGAGTG
AGAAGTAGGGGCAAATAAATATCTGCAGCCGGGCTGTTGATGTGTCTGAGGACGATCAGTTCTGAGCATTGTAGACGGCGGATAGACATTCACTTGATAC
ATTACGTCTACGTTGAACTGAACACAACTTTTGCCGCCCAAGCGTATGCTAAATGTTCGCACAGCTCGATTGTCGGCCATTGACAGAGTATCTTCGATCT
ACGAAAGTAAATTCGCGAGAGGCAAAGATCTGACACGTCCATGTCGACAAAGTTGTGGAATGGATGGCCCTTGTTAGACATTGACATAAATGATGATGTC
AAATTGAAAATGATCTTAAAGGTAAGACAGGGGAGCAAGTACGGCTCCTACCCGGGTTTTTTGGGGGATTGAGGGCACCCCCAGACCCCACCCCCCAAAG
GGAGACCCACCCCCCGGGGCCCATGGGGGGTTTTCGGGGTGCATATGCAATACGTGCTCTGTCTTCCTTGTGTAACTACTGTCCAATAGTGAAATGACGC
ACCTCATTTGAATCGATTGTGCAAGTGTCACTAGTGTTACTGCCGTCCGTGTTAGAGTGCAAGGAACTCTTTGGGGCTAAGTTCCATTCGCCAC