Description :
From Genome Similarity Track
Location :
Scaffold_1534:1- 4383
Sequence
4381 bases(100 bases per row)
GACCTGTTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCA
AGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTCCTCGGCGTATGGCGCCGG
GGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCAACCTAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACT
GTGACCGGCCCTTGCTTCGAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGATTAAGACGTCCGACATAGAACGT
CGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTGTTG
CTGCCGACAGAGCTGACAGTGCCAAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAAATATACTTAAGTTTCGTCTTCCTTGTTTGT
CTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGAACCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCG
CAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGA
GGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCG
TCGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGC
AGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGA
CCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGAC
ACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAG
GCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTAGCCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTACATGTGGGTCCAC
CAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTTCAGATCCT
CGTCGTCGGGTACGACCACCCGTGGAGGATCAGTGGGCTTTACTTGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCG
CGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCA
TATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCAAAGTCGGGACGCCTAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTACTCGA
CGCGGAAGTTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTA
GATCACAAAGGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAATGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCG
GCGGCTTTGAGCTGCCTGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGC
AGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTC
CCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAACCCAAC
CACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAAC
CGAGAACTTTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAG
ATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGC
GTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCG
GGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTT
TCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTC
GGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCC
ATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTATTCACCAC
GTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGTTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGG
ACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGAGGTTGGTCA
GGAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGTATCTCTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTC
GCCATCGACGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGTGTCGCTTGAAGCGACGTCGATCGGAACGAAGCTC
GGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGG
CACTCGTGGCCTCGTGTGATACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTT
ACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGATCGCGTGCGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCT
TTCTTCTTCAGCTATGGTCTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACATCTGCAGCTGTTCTGCGGAACTAAGATAACCC
GCCTGTGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCGGGGCGCGGCCACCATCAAAACATCCTCGGAGTCGTCATGTACGTCGACGACTCCCAAGCA
TCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGG
CGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTTGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAA
CAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCGACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACCGA
CACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCGGACAACTGGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAA