Description :
From Genome Similarity Track
Location :
Scaffold_1539:1- 4369
Sequence
4367 bases(100 bases per row)
GGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGTACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGAGC
GAAGATGAGGATCATAAGGGCGAATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGATGCGGGTGGAACATGAGAAACTG
TGGGTTACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAATGTCAGCGATAAGAGACTATTAC
TGGATCATTATGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCAACCTGGATATGTGTCAGCGGGATCCCGCCGCTACAAAGAATGGCA
GAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCA
ACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTGAGATA
ACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGTTAAAGCCGAACAGCCGGATTCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCC
TGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTTTCCCTGATACC
ATAGTACCTGATTCCCCGAAGACAGACGGACTGCCAGGCGAAAGAAGGCCGCGGTGTTCGGATCCCAATGATGGATCCTACGAAGACGGAAGATGAACAA
GGCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGACCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTG
ATGATATCCAAGTGGATCCAGGGGCGAATGAATCTGCTGAAGTGGATCGTCTGCGTCAGAAACTCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAA
TGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATTGATGTCGGTGACGCGAAACCGATCGCTCAGAGGGTGAGGAAGGAGGCGCCTCAGTTCCGA
GAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCTACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGA
ACGGGGTGGATATACGTCTGTGCATAGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGA
TCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACC
CCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCGCTCTATGGATTCACCC
GAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATTCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGCT
AGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTATACTAAGTGG
AATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGG
ACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATACAATCCTTCTTGGGCAGTTTGAACTACAACAGTCGGTTCATCGAGGATTA
CGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGG
GAAATGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGCGAGAGGATCCAG
TCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGAATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCAC
GCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGGACATGAGGGG
GTCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCCGAATGAACTGAACCACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTG
GATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCAGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTT
TGGGACAGTGGGCAGCTTTACTCTCGCTTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACAAGATCCTGGGCGTCTTGGCCGCGAGCATCAC
TCCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAAACCCCGATCCCGACGGTACAAGTGGATGAG
GATCCGTACGTACTTAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTAC
GGGCCAGTTCCACTTATGCAGAGGGCCTCACCGTCAATGAAGCACGGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATTCAAAAAG
GCTGGTGATTTGTGGACATTCAAACTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCTAACACTGTTACGGCAGAAAGTGATGA
TCCACCTGCGTGGTTGGATGAATCACGAGTTGGTACACGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATG
TGGGGTTGGGGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAG
GTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAGCGGATCCTCAAAG
CACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGGGTCGGGAGGATACCAAATCCTACAGTATGGTTGC
TACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAAGATCGGGATGGATTGATGAGGCTGGTGATGCCA
GAAACCTTATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGGCCTACCAACGGATCCGAGAATGTTTCCACTGGAGG
GGACTAATCAAGAGCGTGCAACGGTAAGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCC
AAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTT
TACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAGTCGTACGAGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAA
ATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGAGGCAGCGACAGCGAGCAACCATGGCATATCGTC
CCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGC
AGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAA
GCGGCCATCTCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCC