Description :
From Genome Similarity Track
Location :
Scaffold_664:1- 4128
Sequence
4127 bases(100 bases per row)
AATGTACTTGCGCACAAGCTGACACTGGCGGGGCCAGTAAAAGTCGCGACTTACCATGAGATAAGCCTTTTCGCGCCAACGATTCCCACTAGTTGGTGCA
TCGTGGCACTCATACATGATGCGTAAGAGCAAATCATTATGAGTGGGGACGACGACACGCGGTGTATCGCCGGTAACGGCTGTATAATACAGCAACCCGT
TACGTGTTGAGTATCGATCCGCGGAAGATCGATACAAGGCCGGTAAATCTTTGAGAGATTTAAGAGATGGAGTCACCAGATGATCCATTAGTCGCAGAAG
AGCCTTATCTTCTGCGTAAGCCTTTTTGATGTCGTCAAGCAATGTTGACGACGGAATACTAGTGACTAGTGTTTCAACAGTGGTATCTACCTCACTGTTG
GACTGCGCAGCCGAATCGAAAGCGGGTCGGCGTGACAACGCATCCGCGACGACATTAAGTCATCCAGGTTTATACTCGACGGAGAAGTTGTACTCCGCAA
AAAAGGACAGCCACCTCGCCATCCTTTGCGAGAGGTGTGGACTGTTGACGGCCGTGCGTAATGACGCATAGTCCGTATAGACTACAAACGGCCTATCCGT
AGGGAGATAAACGCGAAACTTCGCTAGCGCATACTTCATGGCAAGGGGTTCCTTGTCATGCACCGAATAATTACGCTGAGATGCTTGCAGCTGACCTATT
GATAACAGACGACGCGCTCTGCGCCGTCTGCATCGTACTGCATTAACGCGCAGCCGATTGCAAAATCGCTGGCTTCACAGACCACATGGAATGGTCGGTA
TTGGTCAGCAATCGCCAAGATGGGCGATTGCATCAAGCTCTGCTTGATACCTTCAAAGGAACGCTGACAATCAGCGTTCCATGACCATTTATCGTTCTGT
TTCAAGAGACGAGAGAGATGAACAGTCATCTCAGCGTAGTTGCGCGAGTACTTGTGTAAGTATGCCGCTAGACCAAGGAACTTTCTAAGTCCCTTGACAT
CGACTGGCACAGGCCAGTCGGTGATCGCCTTGACCTTTTCGGGATCAGGGCGCGTGTTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTAAAAGCGA
ATATACACTTCTTGAGACTGGCGTACAGCTTATGCTTGAGCATAAGTGTAAGAACATGACGAACGTGAGTTCTATGAACCTCTACGTCCGTCTTTCCGCC
CATATCCCGGCTATGGACGAATACATCGTCGAAGTAGCTCGGTGCGAAGTCTCGCACCGGTCTCAACAGATTTGTGACGCATCTGTTGAAGGTGGCAGGG
GCGTTGCTAAGCCCTTGTGGCATTACTAGCCACTCTCAAAGCATGCCGCTCGGGGTGCTTAATGCCGTGTACGGGATGTCCCGTTCACGCATAAGGATCT
GATAGAATCCATCCATCAGATCCATGGACGAAAAGATGGTACTCTTTGACATACCATCAATTATTACGCCCTTCCTCGGTATCGGCTTCTAAGCCGGTAC
CGTTGCAGCATTCAACTTGTTGAATGCGTGCACTATCCGCCATCCTCTCGTGGCCTTGCGCACACAGAAGGTCGGACAGCTGTGAGGGAACGTTTAATCC
CTCGCATGACCCGCAGCTAAGCGATCGGCAAAGAACTTGTCGATCCCAAGAACTTGTTCACGAGGCAGTGGCACTGCTTCATGACACAGTACTTCGAGCC
CGGTTTAAGCTCGATCTCATGTCGAGTGCCTTTATCCTTAGGCAATTCGCATGGTACAGATTCAGGGAACACGTTCTTGAATACGATCAAATCCTTATAT
AAAGGATTTGCCTGAAACGACTCCCAAGATTGAGACGTGTATCTCTCAATCCGAGTCTTCTCATCGAGGACACTTTCGACCATTGATGAGCTGCTGAGAA
CCCGTTCGTTCTCTGCAAATAATACTGCCGACCGAATTTCAGTCACGTACTCGTCCTCCGTGACGAGTACACAAAATCTGCTTGATCTTGCCACTACGCA
GATCTCGCTAGAACCATTTCGGTTCTAGCGTTGGCAATTGAGTGATCTCCGACTTTGGATGCGCGATCAGATCAAGTGTATACGCGCCTACAATTGACCC
GTCATTAACCAAGACATTCACTGTCTCAGTTTCTTCCTGGGAACCCTTTTCCACAGGATGCTGGGGGCTTATTCTCTCGACGCCTTCTACTTGTGGTTGC
GCTACCACAGCTATGTCCTCTACGATAGAATCTCCATCCGATCTAGGATCATCGTGTTGCCCTGTGTGGACAACCGGTTTATTCTTACTTAGATGTCGCC
CGCTAGGCGTAAACCCATGTCCCGATCCACTCGACTTATTCGAGTGGTGGACTTTCGGCGCTGCCTGTGCATCCGCACAGCCGCCGGCAGCTTCCTTCAC
AGTGTGATTGGTTGTCACACTGAGATGTTGTGCAGTCGTACTAACCACCGTACCGCAAGTGAGGCCATCGCACTCACTCGCAGTACACCCACACGCTTTT
GGACGCTCCAAGGCGTTCATCATATATCCATCTTATGAACAAGTGGCAGGCATCTTCACGGTTCGATGCTGCCAGCTGACCCTTAGCTCGTACCTTCTGA
GCCAGGGTAACCCTAAAATAACATCAAATTTTTCATCCAAATCAAGTACGATGCAATCATCATGGTACTGCAAATCTTCTAACTTGTAGTGAAATCCCAC
TACACTTTTCATCACTGCTATCGATGCGCCTGTTGTGAGGCGCACCGTCAGCCTCGTAGGAGTAGTAACGCGCTCAACGAACTTGAAACAACGATCCTCT
GGCGACTGGCGACGAACAAAGTTGTTCGACGCCCCACAGTCAACTAAGATACGAAGTGACAAATCTTTCGTCACTTTTAAATTCAAGGTGATGAAGGGTA
CCTCATCACCAAGTGCTGAGACACACAAGGATTGTGAGTCTGGAGAAACTTTCATCATCGATTTGCAAATTCTATTGAGGTTGCTCGATCAGTAGGGCGC
TCCGCCCTTACTGACCCCGACCGTTTTCTGACGGTTCGCTATGCTGTTGTGACTTCACAACAGCGTCGGACCCGCGTCCGTTGCCCTTCTTGGCAGACGG
TCGATCACTTCGCTCAGTGTTTCGAGACACTGGGCGTGAAGCACTACACTCGTAAGCGTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGCAATCGC
TTACTGCTTGAAGAGCGAGGTCTCTCGCTCTCAACACTGCAGAGGTCCATTGGTTTTGGTCCTCCTGCCCCTACTCGTCTCGAAGGACGATAGGGGGTCA
AGCTAGTGTGAGCCTGTCTCACACTAAAGCCTCTTGCACCGCAGTTGTAATCGCTTCTTCAAGCGACTTCAACTCGATACGAAATAGGTGGTTCCTCACG
GGACCATCTATGAGGCCCTGTAAGAATATCGTGATCAACACGAATTCACTTACAGCATTCGCTACCATGCAACTTGCAAGGTAACGAACGTGCTGAGCGT
AAGCGGGAACGTCAAGCTTACTTTGTTTTATCTTCAGGAGCTCTGTTAGAGTCTTGAACTCAGCTCTTGGCCGCTCAAACGTTTGGCTGAGCAGAGTCTT
AAAGACCGCCAACGATCCAAACACGTTTGGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCTGGCACGCCCTAACAAATTCGATTGGGCAAATGCAACT
TGCATTTCCTCGTCGTGGATGTGGCGAGCTTTAATAGCATCGTCCACTTTGAGGAATTATCTCAACAGGGAGTCTTCCTCGAATCCCCGGTAGCAGACTG
AGACTGTTGCTGTATCAGGAGCTCAGTTTGGAGGTGACCGTGCTGATGCAGCAGGGTCACTTCAGCTTGCGACGCGTCAAGTTCTCGCTGCAAGAACATG
GCGATTATGCTGTTGGTCCCTATCCCTTGAGGATATCAGAGACCAGACAGCTTCTTCACCAACGGTCGAACTCATTCGTTCGACTGCACTCCATTCGACA
TCACTCAAATAGGAGTATCTTTCATGGGTGCCGTGATAGGTGTCGTCGCCTTCGTCGTCCAACACGTTCATGTTGAACGGGTTTGTGGTCCTTGGACGGA
CCAACAAGTGCTACGAGGTGTAACGGG