Description :
From Genome Similarity Track
Location :
Scaffold_2866:1- 4077
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2866-snap-gene-0.1HECT E3 ubiquitin ligase

Sequence
4076 bases(100 bases per row)
GTCTCCTCCTCCTTGGTCGCGCTGTGGAGCCACGTGTTGAGTACGTTGTCCAGTCGCTTGAAGCCGTCGAGCGCCACGAGCTGGAGCTTCTGGGGGTTTG
CATTCGAGTAGCCGCCATTTTGCAAACTAATGGTGGGGCTGTACGAGCTCACAGATGATCTGGTGAGTGCTGTGGCGGTTGTAGGCTGCGACTCGGAGCT
GCGAGGCGTCAAGGTGACTAGAGCGCTCTTCCTCAGTCTGTTGTTGTAGTCCATTTCAAGCTTCAGGCTCCAGGATCGCAGGTACGCGACGCCTTTCTCA
AACTGCGCAGCGAGGATCTCGTTCATCTTGACATTGTCAAAGACAAACTCACTGTTCAAGAATGCACAAGGCACGATAGACAAACAACCCACGAGTCAGT
CTCATGTATTCGAGAGATGGCATCTGTAGTGACTTGAAACGCACTCCATTGCGACGCTGATGCACCGCTCGAGGATCCGCGGACACAGGTACGGCCATGA
GGGCGACGGCGACGCCAGCACACGCTTCTCAACTGGATCCAGCAATTGCAGCACGAGCAACTCCATGAACTCCGTCTACACACACGTCACGAGTACCAAA
ATGCATCTGTTACTATACAACAGTCGTGGATATCATCCATTCCGATTCGTCACGCACGACTGATCCTCGTGACTTGGACGCGTCCTTGGCCATGAGCGGA
CGACACAGTCGGCTCGCATTCTGTTGAAATGAGGCAGTCAGTTAGTCTCAGGTCACACACATAGTCAGACTACAACGTGAGCTGACAGTACGTACGGCCT
CGGTGGCCTCGAGGATGGACTCGGTGAGCTCGGCCAGCTCGCACTTGTACTCGGCGTGAATCTCCTCAAACTCCAGCGAGATTTTCTTGATCTGCGGGAT
TTGCTGCGGTGGTCTGGCGATCATGGCTGGCCCAGCTGAGACTGAGGCTCCACCCGTGCTTGGACTGGTGAAGCTGGTCGCTGGCTTGTGCGGCGGCCTC
GCGTGCACTCGCTCCTCCTCCACGCCCTCGCTCAGCTCGATCAGCTGCACCAGCCTGTCGCACTCGACCGTCACCTTCATGAGCACACTGTGAAGCGCGA
TCATCGTCACGAGCACAGTGGTCGACGGTATGGAAGAGTTGGTGTTGATGTTGGGATTGTTCCCTCCATCGCTTCCACTGAACGCCCAGACGACTCGCGT
GCGGACCACCCAATCCACGTGCTTCCTCAGCGACGGCAGCAGGATTGACAGCAGCATCACGAACGGACACATCGGAGGCGCGTTGTTCGCGTCGCTCGTG
CTGTCTTTGAGCACCTGCGCAAACTTCTCGAGCACCTTTGTACCCATCTCGCTCACCACTTTTTCCTGGAAATTGTCGCTCACGGACAGCAGCGTCATTC
GGTGGATCTCGCCATAGAGCTGCGCGCACTGGCAGTAGAAGACCGTGACGAGCGGGCTACGGCGCTGAAAGCAGGCGGAGTTTGTCACGAGCGGGTTCTC
GAGGCCCTTGACGCAAGAGGCGCCGCAGGGCATGTCGTCCTCGTGGGCACAGAGCTCACACGTCGAGCCCTTGCGGGTGCGGTCGCCGGACCCGAGGCCT
TTCTTGTGTACCTTCTTCTTGTGCTTGGACTTCATTCGCTTGTGTGGGCGGTTGGCTGCTTGGACACAAACCTGCACTGCTGAGTGAATGAAGTGGGTGG
TGTACAAACGAGAGTCCTCGGTTTCAAATTCTCATCCACTGCACTGCATTTACTATAAATATATAACTGCTCCTCATTCATACAACTGATTTCGAAAATA
TGACACGCAACGCTACGTATTCGTACCCAACCGACGCCCACTTTGCCGCTGGAGGTCTCATAGAAGTGAGACTCTGTATATCCCCTCAGAGGTCATTCTT
AAAACTGGGGAGCACCTACTCGAAGCCGAAGCCCGTAATCTCCATTTGAATCACCTGGTAGAGTATCAGGAGAAAACAGCGTTAGTGCCAGGCAAGCAGC
AAGATAACCAGACCTCTCAGAGTACAGTAGGTAGGTACGTACCAGAGTCAGATACGTGACAAGGTCCTCCTTGGTCTTGTAAATCGGCAGGTCGATACGG
TTGAAGCACGTGTGTGCACGTGGACACAGTCCCAGCGGCGGGATCCCGATCGGCATGAGCTGCAGACTGAACGGGTGGACGTACCCGCTCGCACTTGTCA
ACGCCTTGAAGCCCTCAACCGGCACGCGCGCCGAGCCTGTTGCGAACTGCAGCAAGCGGGCTCGCTCTTCGTCGGAAAATGCGGCGACGGCCTCCCAGAA
CCACACGACGACGCTGATCTCATGCTCGAGCATGGGGATGTTCTCCGAGTTGAAGTGGAACACGCGCGTGTGCAACTGCCAGTCCTTGACGTCGAGCATG
GGCAGCCCTGAGAGGAAGAAGTCGAGCTCCTGGTAGTCAAACACGCTCAGCATGCTCTTCGGGATGATCTCGTAGAGGCCCGAGAGCATGGCCGCCAGCT
GGTCCGAGACGGAGCCGAGCATGCGATAGCGCAGCATGAGCGCGAGGTACTCCATCTTGTTGTCGTCCGTCACGTCGATCTCACTCCCGTTCGGCTTGAG
GTCCACGATCTCGCCAGCCGCGTCCTGGATACTGAACGTCACGCAGAGACTGTCGACGTTGTCGTTGTCGCGGATCCACACGGCGCTGCGATAGAGCTCT
TCATCGAGGTACTCGAGGTCGGAGAACGTGATCGGGACGCTCAGGAAGTGCTTGAGGAGCGGCAGCGCCATGTTGGTCTCAAATATGAGCCCTTCGAGGA
TCGCCTTGCCGAAGAGTCTGCCCGCGAACGTGTAGTACTTGAGGTAGTCCTCGTTGTTCGGGAGCTGTTTGTTGGGCGTCGCGTTGATCCAGTAGCTCAT
ATTCTCTGCGTGGGTAGTGCAGAAAAGCCCAAGCTCGGCGCTGAAGAGTTCCTTGCACACGACGCCGAACCACTCGCGCAGCACACCGCCCGCGTCCAGC
GCAGGCTCGCCCACAAACGTGATGTTGGTGTGCTCTCTGAGCTGCCTGGGCGTCAGGTATCCGCCGAGCGCGATCACTGAGTCCTGCAGGATGTGGTCTC
TTCGTACGGTCACGCGATGTAGCGATTCCATGTACGGCACGGCCATGCCAGCCACTTGCTTCAAGAGCCACTTCTTCTTCTCGCGGAACGTCATGGACAT
GAGTCCTTCAAAGTCCAGGTCTGCCGGCTGCATCGTGTCCCTGCCTTCGTCATCTTTGCCTCCTCCTGCGGCGTCGATCTTGATCGTCACAGCATCGGTC
TTGCGCCACACTAGCGCGCCGTCGCCGTCGAGCTCGGTGAAGAAGCCCATGGTGGCCGCGTTCTTGCGGCGCAGCTGCTCCGCGATAGTTCCGCGCAACG
CATTCGCGTGCGGGTTCTTGGTCAGGAACGTGTTGTTGCGCAGCTTGCCGAGGAACGAGTCAGCTTTCTGGAGCGACGGCTGCGCTGTGCGCACCCACAC
GAAGGCGCCGTTGGGGAGCGACACGCGCTGCCAAAGCCGCCGTCGCTGCGCGCTGCGCTGCTTCTGGTTAAGGCGGCGGTATCGCAGCGCGCGCTGGCGC
CCATTGGTCGCGATGTCAATGTTGTCCATGTTCGTGCCCATAGTCGCCCCCGAGGAGCTCCGGAGGATCGGGATGTCGCTCGAGTTGAGGAACGCCGTGT
CGTTCAGAATGCTGCTGTTCTGGCCGCGGGTCGTCGAAAGTACGCTCAGGTTGGCGTTGAGCATGCTGCCGTTGAGCAGCGAGGCGTCCACCGAGGCGCC
GCAGAGGTCGCACTTGGCGTGGTCCGGGTGGTTCAGATGGAGGCACACGACGCACTGCCACTCGCTTTTGCCGTCCTCGAGCACCGTGTCCGCGAGGTTC
TCGCGCAGCAGCAGGTCGCGGCCGTCGATCATGTCGATGTTGAACCCGTAGAGCGGGTCGTCATCGTGCTCGTCGTCGCGGCAGTGACGCGCGCAGAGCA
CGATGAGACAGAAGAGCACGAACACGGCGGCCGCCATGCCGCCCAGCATCACGTTGATGCGCGTGCCGCTGTCCAT