Description :
From Genome Similarity Track
Location :
Scaffold_590:1- 4065
Transcript NameFunction/comments
g17698.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g17699.t1ETP25916.1 hypothetical protein F441_01272 [Phytophthora parasitica CJ01A1

Sequence
4064 bases(100 bases per row)
AGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTCCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATT
GGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCGTCCGATCGCGAAATCGGATGCGTCACACACAACGTGGAATGGGCGATC
CGCCAAGATCGGCGCCTCAGTCAAGCCCGGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGC
GACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAAGGCGTA
GGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGTATCTCGGTCGCCCCGAAGATACA
CTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATCTCCCATTCACAGCC
CGGCTGTGAATGAACACGTCATCGAAATAGATCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGGGGTTC
TTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGA
ACCCGTCTCTCAGATCCAGAGTACTTAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGC
ATCGTTCAGCTTGTTATACGCATGGACGATGCGTCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACT
TGTCCTGCTTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCA
CGAGATCAATCTCGCGCTGAACACCCTTGTCCAGCGGTAACCCGCAGGAATGTCGTCCGGGAGTACATGCTTGTACTCACGCAAGACCTTGTAGAAGGGG
CTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCCTCCGCGCCTTCAGAGATGAGCTGATTCAGCTCTT
CTGCTTCACACGTCATCCTCTCGACGTCAGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGG
GAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCAGCTTCTTATATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCG
ACGGTCGTCTCCAATTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCAC
TTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCAC
GCGTCCAAGCCAGGCTGCACGCGAGCTCGCAAGAATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCG
CCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACCTTATCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACC
CTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACATTTCCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGC
CGCATTCCGCGCTGTCTCTGGTGGAGGGCCGCACGCACCACGTGGTGCATGTGCTGCGCCGACAGAGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCG
AAGCGCACGATCGTGCGCTTCTTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAAGTCGAGGA
CGATAAGCTCGTCGACGAACTCCTTCTCTTGGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTC
CAATAGACTTCGAGGTGTTTCCACCTCCTTGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAATCCACTAGAGCACGA
AGAGACTTCTCTCTCTTCGAGCTTACTTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCT
TCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGTTTGCCCGTGACGATAC
CCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCTGCAGCGGAAACAACGCACATTCGTTG
ATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCTGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATTAGCCGTGG
GGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCTTCGAGAGTATTTGGATACTCTCGGAAGAGATAG
GTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATATTCGAGACCAAGTACCGTGCTC
TTTGGACGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAG
CTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCG
AACGCAACCTTCGACAACGGGTCGACGATACATCGAGCCGTAATGGCAGTGTCGACCTCAACAAGCCAACGGAGGAGAGGATCGCTCTCTCTTCCAACGT
AGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACC
CAGAGCAACACCGTGTTGCTCAGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCAC
TCTGGTTCCGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGC
CCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGTCTGCTTAGACCCACTACTTAAGCTT
ACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTATTTAACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAA
CGATAGCTTTGGTGCTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTTCCTCCTAAAACTGATATTTCTAATGAGAGGT
TCTGTCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTATTTTCTACCAGTCATATGCCTTTTGCTATGAATGT
GGACCACCCTGTGGTGGTCACCTGAATGTATCTCTTAGTGCATGTTGCACTAAGGTAGGAGGTG