Description :
From Genome Similarity Track
Location :
Scaffold_455:1- 4056
Transcript NameFunction/comments
g14568.t1hypothetical protein

Sequence
4055 bases(100 bases per row)
TCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGTGGAATCTTCATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAA
CCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAA
AAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGAAATCTCCCGAAAGC
ACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCT
CGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTT
GAAGGTAGAATGAGCCGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCC
AGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGGAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCT
GATCATAGGTCAAGCGCTGCTCCTCGTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAG
ATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGAACGGAGTACCCACTGACACTGAGCAAGTCT
TGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGA
ATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTC
CGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGG
TCTTCGAAAGACCTCGGTCCTCGGTGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAG
CCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTC
GGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCCAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACG
GTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATA
TGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGA
CCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTG
TACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCTTTCCATATCAGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCC
GTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTCCCGCTCCACAG
GGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAG
TACGCGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCC
CAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGAC
CCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGT
AGGACTGGTACATTGCGCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCACGGCCTCG
ATCAGGGTGGACCAACGTACCATCGCCTCTGTTGAACTCAGAGAGTAGCCCTTCGCCTGTTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCATCCTGA
AGCCCTCGGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCT
GAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCG
ACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATACGGAAGCAGAAGAGGATACTGAAGCGGATCATACTCCGGGCGCGTC
TCGAACAGTCGCAGAAGCCTTTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAA
CGGTAGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCC
GAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGG
CGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAATTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAG
ATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACCTCCTGGAAGGATCGGTT
GGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGTTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGA
GGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAG
TGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGC
CGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCAAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTACCCTTCGCG
CTTCAGCACGCTCCTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGCTCCTGCGTAAGCTGTGA
TCGTCGCTCCGCGTGTTGCTCCTGGTTTACCATGCGATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCCTGGTTTACT
ATCCGTTCCTCGGCACGCTCCTCCTGTGTGAGCTGTGATCGGCGCCGGGCATGTT