Description :
From Genome Similarity Track
Location :
Scaffold_1273:1- 4023
Sequence
4022 bases(100 bases per row)
CAACTGACACGCAAGGCTGCGAGGAGGCGCTGGGTCCAGCTGATGTGGGACAGGCGGCCCATCCCGCTGTCGCATCGGGTGGTAATCACGAAGAGACAAG
GGGCGGATCCGCAGATGCAACATATGGTGCTACGGGACAGGCCATGGATCCAGTGGAACGTCAAGTTGCAGATGGTGAGATGGGACGGACTGCAGATCCA
GACGGAGAGAAGAGACAGAAATCAGGTCCGACGTCAGATCCAACGTCCAGCCCCGATCCAACGACCACTGAAAATCCGCGGTACAAAGACTCAGAGGCAG
ATGACCAAGTCTGTTACCATGTGAGCGGAGATCTACACGCGGAAGACGTTGAAGCTGAGATGGCCGTATTGCCCGAAGTTACTCCGGCTACAGAGGAGGT
GACAGTCGAAGACATCCAAGTGGGAGATCCAGATGTTAATACGGCGGAAGAGATTGACCGACTTCGGCGACGGATCTACACCTGCTGATTGGCAAAGGCA
ACGCGCTGCTTTTGCGGCGCGAGGCGTCGTGTGTGACATCGATGTCGGGGATGCTAAACCCATTGCCCAGCGTGTGCGGAAGGTGGCGCCGCAGTATCAT
GAGAAGTTGTCGGATCTGATCATGGGATTGCTCGGTGCCAAGATCATTAAGGATTCAACTTCCCCGTGGGCATCCCCGATCGTGGTCATCATCAAGAAGA
ATGGAGTGGATATAAGGTTGTGTATTGATTACCGGCTGGTTAACAGTCTGACCAGACTGATGATCTACCCGATGCCCCTGATTAATGACCTACTGGAGGA
TCTGGACAAAGTGCTGTGGTATTGCTCGTTGGATATGGCCAGTGGATTCTCGGTGGTGACTATGACGGATCGGGCTCGTGCGATTTCCGCTTTCATCACC
CCGTTCGGATTGTACGAGTGGAACCGGATGCCCTTCGGATTGAAGAATGCGCCTCAGATATATCAACGGATGCTGGACAACGCGCTGTACGGGTTCACCC
GGATCCCACAGTTGGAAGGTGGATCGGGATCGGACGGCGGATCGAAGGTCACGTGTGGGATTGGATCGAAGTCACTGAATCTGGATCTGAAGGCAGGAGA
GCCTGAGGACCCTGGCAAACCGTCGGTACTTGGACGGCGATCCTACATTGATGACATCTTGGTGACCGCTGGATCCTGGGACCACTTGTGCGACCGGGTG
GACGCTCTGCTGGACGCGTGTGATAAATGGAATCTTTCGATCAGTGTGGTGAAAAGCTTCTGGGGCAAGAGCAAGGTGGAGTTTCTAGGCCATCGAGTGT
CCCATGCTGGATTGGAGGCAAATCCTAAGGATCAATCAGCCCTGACGAATCTACCCTTCCCAGGGTCCCTCCGATCCATGCAGTCATTCCTCGGCAGCCT
GAACTATTACAGTCGGTTCCTGGAGGACTATGCGATCTACGCTGCAGTTCTCTATGAGCTACGAGAAGTGGACTTCGCCGCGATGAGTAAGCCGGACAAC
CAAAGCGCATCCAACTCACCATGGGTTTGACGACCTCGGATCCAATAGATCGGCACTCGTCGGATCCATTAGGGCCGAGGACGGTGGATCTACAACTTCG
ATCTACAGAGACTTTCGACCTGGAGGCGAAGGATCCTGTTGGCGTGAGGACTTTGGATCCAGAGGCATGCGACCCAGGCAATGTGGATCTACGCTGGATC
CGAGCTCATCGGGCCTTCGCGACACTGAAGGAGAAGGAAGATGGCGAGGACTCCAATCCTCCGACACTTCAATATGGATCTGCTGCCAGTGGTGGTAGTG
TATGCTAGCGAATGGGCCATTTCGGCCGCTCTGATGAAGGAGTATGACGGGATCCAGTACCCAGTCACCTTTACCAGCCGCACTCTGAAATCGAACGAGC
TCAATTACGACGTCGTCGAAAAGGAGGTGCTAGCCCTGCTGCGGATTCTGGATCTGAGCTACAATATGTTGGTGGGTCGCCAGATCCGGGTCCTGACTAG
GCACTCGACTCTGGCCTGGCTGTTTCGATCCACTGGTCTGCAAGGACGGCTCGGACAGTGGGCCGCACTCCTTTCGCCATATACTCTTGAGATTATGAAG
TGCGCAAAGGGCGAGGACGAGATCCTAGGAACGCTGGCAGCCAGTATCACACCCCGATCCAAGGTGGATCGGGCATTGATCGACATCGCACCTAAGAAGG
AGCCGCGACGCAATGTCCAAGCTCCGATCCCGACAGTACAACCTGGTGAAGAACTCTATGTGGTCAGCTTTGATGGATCAGCGCGTGTCAAGCGAGGAGG
AGGCGCCTACAGTGCGAACCTTTGGAAACTGCCAGAGTGGAACGTGGTGAAGGCTAGATCCGGGTATGCCGAAGGTCTCTCCGTCAATGAAGCAGAGTAT
CACGGACTTCTGCTATGCTTGGATCTACTCGAAGGCGAGGCACAGTGACGACTTGTGATCTGTGGTGACTTCAATCTGGTGGTCCGCCAGGTCCGAGGTG
AGATCGACTGCATGGCACCTGGATTGACGCTGTTGAGGCAGAAGGCGCTGGATCGACTACGTGTCTGGCCCAACCACGAGCTGGTGCATGTCAAGCGCGA
CTGGAACGGTAGTGCCGACACTCTCGCTAGCGCGGCACTCCAACGTCAAGCCGGAATCATGGTGGAGGGTGAAGCGGACATGCAGGATCTAGTCACCTTG
AACCGCCTGGATGAGATCCTGGTGGTGAAGACCGAAGAGGATGCGTCGCTCGGGTGTCGCCCGTAACAACCCGAGCTGGTGCAAGATCCCGATCCAACTC
CCGACCTACATCCAATTCACAGGTCCTACAGGAAGAAGTGGTGAGAGACCTCCGGATCGCTAGGATCCGCCAAGCGCAGGACGAGGAGGCGTGGGTCTCC
GGCTTGAAGAAGTATCTGGCGGGCGACATTCAAGGTCTGACGCAGGAGGAAGCCCGATCCTACGGTACTATTGCGATGGATTACGAAATGGATCGGAACG
ACCTGCTCTTCTACTGCCCTCCGACGAAGAAGGTGGAGGCGGATCGCGATGGATTGATGAGGTTGGTGCTTCCAGAGACGCTGCAGCGAGATGTCCTTCA
TCACTACCATGTCAGTCTGGAAGGAGGCCACGAAGGGATCGGCCGTACCTACCAGCGGATCCGAGATCACTTCCACTGGAGAGGCTTGTATCGGAGTGTC
CAGCAATATGTCGGAGAGTGTGTGGATTGCGAAACCGGCAAGGGGCGGCCCACGATCCAAGGCGAGTCGCCTGGCAACATCCAAGCCACATACCCGTTCC
AGATGATAGCGATGGATCACATACCGTCGCTGCCCAGATCCAACAAAGGTAATACCGTCTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATTGCG
AAAGCCAGTGACTCTCGAACCGCGCAGACTATTGCGGAATCCTACGAGGAGTGTGTCTTCAGGAGATTTGGTGCCAGTGAGGTGATCCGACACGACCGTG
AGCCGGGGTTCATGGCTGACTTCTTTCGATCCTTCAACCGGATCCTAGGTCAGCGACAACGCGCAACAATGGCGTATCGGCCGCAGGCGAACGGAACAGC
AGAACGCATGGTACAGACCGCCCCCGGGCTCTCAAAATGCATGTGCAGGATCTGGATCAACGCGATTGGGACGATTACGCGGAGCGACTCACCTTCGCAC
TCAACACCGCACAGGATCGGATTCGCGGAGAAACACCTTCTACTTAGTGCATGGATGGGATCCTAGATCCACCCTCGAAGCGACGATCCCGGTGGGCAGC
ACTCGCCGTCAGGATCGAGATCCGAGGAGATGGCGGTACCAGATCCAGCGCTACTACCAACAGGCGCGAGCAGAGGTCAGCACACGATTGCAGGAGGCGA
TTGCGGATCGAGCGGATCGGCATAACGAGGAGATCCATCCACATCAGATTGAGACTGGATCCCGCGTCTGGCTATTCTTGGATCGGGTCAAGGAAGGATA
TGCTCGTAAGTTGGCGCACCTG