Description :
From Genome Similarity Track
Location :
Scaffold_882:1- 3912
Sequence
3911 bases(100 bases per row)
GTGAGCGAGAATTCTCACAAACACAGCAATGCCCTCGGAGTCAAGATTCTTCGCGTTGAAGAAGAGCAAGACTAGCTCGCCGACGCTTCCTTGCTTAAGG
CATTTGGTAGACGAATAAACAAACTTGTGCATCCAAAATTTGCGTTCTGTATCAGCGCTGTAGCAGAACGTAGCAAAGTCTCGCATCACCACACAATATA
ACAAGGGGAATCCTCGGTTAGCTATTTTTGGGGTCGTTTACGGGTAGGGCCTGATAATTGGGTCAGGCGGGTTTCCTGACGGCCCTACCAAACACAGGAC
CAATTGCTAAGCTACATATTGAAGTGAAAGATACGAAGCTAAGCAGTTGGGTTAGAATGCTTAGACCACGATGGTCTGCGCGGCACGAGGTTGGTCGGCT
TCAGTGTCGCCTTCATCGGCATCACTGTCATTGCTGATCACACCTGCGCCCAAATTGGTACTAGCAGCGTCCTCTTCGCTGCTAGTACCAGAGACGCCCT
CGTTGTCATCATCACTGTCGACGTCTACAGCCTCGTCATCTTCTTCACTGCTCGATTCTTCTTCTTCTGTAGGAAGATCCTGTTGGAAATGGAGCCTGAC
CCAATAATCAGGCCTGACCTGTATACGACCCCGTTAAAATTCTACCGAATCCTCTTACGCTGCCCCCCATATTCTAGAATATTTATGCGCTTGTCCTTCA
TCAAATTGAGCGCTCGAGTTTCTTTCTGTAGGGAGCGCCTGATATCGCATCGACTTTACTGTCAAAGCGCTCTTGTGTTCTGGGTCGTGCCAATTGACCA
TAAAGTCGATGACGCTGGCCTAGGTGTCGTCGGCCATTCCTCCTGCAGACTCGACACATCATGGGCGTCGTAGCAAACGAAGTTGAATCGATCATCCACA
AAATGATCCCACACTCTGAGATAGGCATATTTATCTCCCTGTACGTCTGCAGAAGCTCTATGAACAACCTGTAGACATCCGAAATAGGCCTGGCTCGACG
CTCGAAAATCTTATGTGCTGCAGTCAGCACGCTTAGCAGAATTATCTCCTTCTTCAGCTGCGAAATGAAGTCACCGACAGTCATACGGCGCTTTGCTGTC
TGCTTCCAAGTTGAATTTGGCCTGTGACCTTGACGATCTCGCCGAATCTAGCTCTGACAAAGAGATCAAGAACGAGACAGCGTTTTTGAGTATTACGAAG
TAATTAGTGCATAGAGCTCAGCAATACAGCAGTTAATTCAGTACTACGTGTTGAGAAGATCAAGACTCAGTAGCCAAACTGAGGATCACCGGGGTATAAC
GCCGGAGCCAAATGAGGACCACCGAATGATAAAATTTCGTAGCTAAACGAGGACCATCGGTCATGAATATTGTAGCCGTAGTGAGGACTAATCGGTCGTA
AAATATTGTAACCAAACGAGGACCACGCTTCATAAATATTTGTAGCCTAAATTGGGAACATCGGCCAAAAGCTGTTGCCAACGTGAGGACCACATATCAG
AGCACATCCGTCCTCAGGAAGCAGCTCCCTAATTCTATTACCAACAAAATCGTTCGTTTACTTGGTTCCAATAAGACATGTGGTAAAATTTGGTCCTCTT
TTCTGTCGCAATGGGACTGTATTCACAGCTGCACAGCCAGCTAACCAAGGAAACCACTGCCAAACTCGCTAGCAATGCATAAAGAAGTGCGTGGAATTAT
ACGGAGTTGGTCTGAGATGAGGGCATGAACGTTAGCGAAGGATTTAATTTATTTGCTAGCAGAAAGAGCTACCTATAGGTCGTTATATCAAATGCAGACA
GCACCAATGTCGTCCTTCGAGCAGTTCAGCTGCTTCTTAAGGAAGGATACTTGCGCGGTGCTCAAAACGAGAAGCGTCTCGGATTATCGCCAACCAACGA
TTTTTGGCGAGGGCGTAATATGTGCAGAAAATGACCTCTAGCGAGATTCTGTCTCGCTGTGTCGTCTATATGGACGAGAACTACATACACCTCCACTATT
CGATACACAGCGATTTGCTAGTCAACCCTACAGATGATAAGTATATCAAAGAGAAAGCATAAGGGGAAGGTTATTAGAATAAACATCATCTTTTTCTTAC
GTAAATTTGTACCAAAATTGACCAATCAAAATTCAAACGCATTACATATTTTATCCTAGTCAAATCGGTTTTCACTATCAGAAGAAGACTCCTCGCACGA
ATCCATGGCTTCAAGATGCTTCTTGAGCTCGGTCAATTGCTTGTTCGCGGCATCAATGCTTGCGCTGAAATTAATGAAAACATTTTCGAAGACGCGTTGT
AGCCTGAACTTAATATCTGTAAAGGTAGTGATTGTCGAGTACTGGCGCCCAACCTCGCCTTCTACGTTTGCCCACACGATCTCAATAGGCTGTATATAGG
AATGGTAGGGTGGTGTCTATATGATTTCATGACCTATTGCTCTTGCTTTGTCGACTATCACTGGAGCTACATTGTCTTTGATGTGCTTGAAGAGTATTTC
CTACAGTATTGCTTTGTTGTGTTGGCTGGAATCTTCAGCTTGTATTCGTTCATAGCGCCAATGATTTTTGCTCTCTTGCTGCCCTGCTTGGGGGTTGTTT
CTGGTAGTACTTTAAGATACTTGGCCCTATCCATCACAATAATGCAATTAGATAGCTCTCTGATAGTGCTTCAAGTAAGGTATCCATCCAGCCCACAAAA
ATATCATGGCAGAACATGCCATGATAATCTGCAAACTGCTTACCACTCTCGAAGCTATCCACTGTGTCAAATAACAGCTCTGCCTCTTTACCAGGCGGTC
TCATCATATCATTAGCTGAACGATCTATTTCAAGGATCGCAGCAATAGAGCAGCTGCTGAGCATGAATTGTTGGTCCTGTTTGCGAAGCAGGTGGTGGAT
TTCGCAAGCGTCCGCGACGAAGCCAATGGAGACTGTGACGGCTTTGCTGACCGCTCTTTGCGTGTGGGCAAGAAACAGCGCATTGAAGCTCGAGTGCACA
GTGGTGACCAATTCATGTCGCCCACCTCGATCGAAGTTGGCACACGGAAACAGTTTTTAGTTGGCTTTTGCACATTGGCCTGTTAGGCATCTTGATGCTG
CCTCGCGCAGTGATGGATTTCACGACACCAAACGCAGACGAGACTGCTCTTTTCATCCGGAAGTTAGCCCCTTTCTTCTCCACCGCGCGCACATCCTTCT
TGACACGGCCACGTGTGCGCTTTGTTTACAGATTGAAATTGGTCTCGTCGAAGTACACCACAAATTTGTGTTGCATCGGTGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN