Description :
From Genome Similarity Track
Location :
Scaffold_1188:1- 3897
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_1188-abinit-gene-0.17DEAD/DEAH box RNA helicase
Pytir_DAOMBR486maker-pir_contig_1188-fgenesh-gene-0.1Beta-1,4-galactosyltransferase

Sequence
3896 bases(100 bases per row)
GGCGTGCAGCTCGGCTGGCTTGTAGATTCAGAGAGCAAACTCCTGAGTGAGTACGAGAGGGATGGGGAGAGCAGCAATGCCTATCGAGTTGAAAGCAGTG
CATGGCGAGATCTTGACAGCGGAGCTGTGCTGCCAGGGCTCAAACTGTGAGCCAGATGGTTGGATGTGATGTTGACGGGTAGGGCAGCGGAGCTTTCATC
TCGTGATGAGTTTGATGTGAGCTGCTTTGATCCGGAATGCAGCGAACGACTCCGATCGTGTGGCCAAGTTGCTGCGCACATGGAATGGCACCGAATTGTC
ATCGCCATCCCATCGCGTATCTCCGTGTGGAGGAGGGTCACCAAGAGTGATTTCAAGTGCGAGCCTGTGAGTCTTTATGGATCGAATTCAGCCCACCACC
CACTGTCTCAAGCTGTGAGGGAGCGAAGGAGAAGTTGCTGGGCAACGGCGTCTGAAAGGCATGCAACGATGAGTATCTATAATGCTAATCGCTGGCTGGT
TTTATACAAGCAAGCGGTGGACACCTTCGTCTACTCTAGCGAATGGATTGGAGAATGCACACCAACAAAGTTCAGACATTTGCAAACTCTATCATTCTGA
ACTCTGGAGCTTCTTTCCCGGTGGGCCACTCTTCTTCTTCTTGGCACCATTTTCAGGGAACTTGGCGCGCTTCTTCTTGTCTCCTTGCGGTTTCTTGTTG
CTCTCATAAGTCTTCTCATTATCGTTGCTTTGGTCGTCACCACCTTCAGTCTTCGACTTCTTCAGCTGTCTGATGCGGTTGGACTTTTGCAGATCGTAGC
CAGAGACCGTGTTGATGCGGTGGCGCTGCGGCGGCGCCTTGAGCAGCTCCTTGCGCGCGCGCATGCTCGTCTTGCGCAACGAGAGCATCCACTGCGGGAC
GTCGCAGCCGGACAGCTTCATCACGTTCGCGATCGACCGAAGGTACATCATGTCGTCCTCCGTGAAGAACGTAACCGCCAGTCCCTTGCGTCCACCACGA
CCTGTTCGGCCGATGCGATGAATGTAGCTCACGGCGCTCTGTGGGAAATCGTAGTTGATGACCATGTTCACGGCCTTAAAGTCCATGCCGCGACTCATCA
GGTCTGTGCAGATGAGCACCCAGACCACGCCCGTGCGGAACTGGCGGATCACGTCGTCGCGCTGCTCTTTCGTGCGATCAGCGTGCACGGCGCCAACGTT
GATGCCATCATAGAGCAGCTCCTGGTACAGTTCGTTCGCGCGCTCTTTGTTCTGTACAAACAAAAGAGCAGGCACGCGCAGCCCCTCGGTGATCAGCTGC
TTCATCGCGACGAGCTTGCCCTCCTCCTTGCCAACAAACACGAGCTTCTGCTCGATCGTCGTCGCACCAGAGTTCTTGACGCCGATCGAGACTTTGACCG
GGTCGCGGAGCACGGACTGCGCCATCTCCTCAACGCCCTGGAGCATCGTGGCGCTGAACATCGCGCGCTGGATCTTCTGGTTCGTGCATGCCGCAAAGAC
CTCGTCGATTTGCTCGACAAAGCCCATGTCAAAGAGTCGATCTGCTTCATCCAAGCACACCATCTGAACCATGGACAGGTCGAGTTTCGTCTCCTGGATC
AGGTGCACGAGTCGCAGCGGCGTCGCGATTAGGATGTCGTGGTTCACCGTCGCGTTGTTCTTGATCTGCGAGGCGATAGTCGCGGCTGTGGCCTTTGAGA
GCAGCACGATGTGGAACTTGCGGCCCTTGCTCAGACGCGTGAACTCGGCGTGGATCTGCACCGAGAGCTCGCGCGTGGGCGACAACACGATCGAGCGGAC
ACCTTCTTGCGCTGCGGGCACCCCCAGGTTTGCGAGGATCGGGATCACGAACGCCGCGGTCTTACCGGAACCAGTGGGGGCTGTGGCCAGCAGGTCGCGC
CCGAGAAGCATCGCTGGGATCGCCTGCATCTGGATCGGCGTCGGCTCCTTGTACTCCGACACCTCGATGTTCTTGAGCAGCACGCTCTTCATCTTCTCCT
GGTGGGCGTTCAGGCGCATGAGCGAGAACTCGGCGATCGGCGCCGGGATGCCCGTGCCTTCCACACGAATGTTCATCTGGCGGCGGAAGAGCTCCACTTC
CTCCCTGTTGTTGTGATTAAGCAAGAGAGTTGAGAGATAAGAGAAAAAGTGAAATGACTTGTTAGCATACGAGTATCATGGTAACCAAGACGACAGTGAG
TGTGGGACAAGAAGAGAGGCAAGACAAGTTGGTACGTACTTTTCTTTGCTGACCTTGGGCTCTTCTTTCGCGGCCTTGCTTTTCTTCTTTTTGGGTTTCT
TGCTCTTCGTGGTAGAAGACTCGGCGGCTTCGTCCTCCTCTTCATCGTCGTCGCTCGCGTTGCTCTTGAAGAGCGTTATATTTTCATCATCATCCTCATC
GTCTTCGTTATCACTACCCTCACCTTCAGCCTTGTCATCTCCATCATGGGACGAAACTTCGCTTCCGACTGACGCGGCGCGCGCTCGGCGCTGCTTCTGC
TTGCGGAGCTTGCGCTTCGTCGCCTTGTCCATCTTGGGCGGTGCGAGTAGTAGCGACGCCTGCTTGCGTTCGTCCTCCTCGAGCTTGTGCTCCTCAATCG
CGCCCTCGCTGAGCTTGCGTTTGCGGCTCTGCTTGCTCCCGGTCTTCTTCTTCTTGCTGCTGCTGCTCGCGTCCTCGTTGCCCGCCCACTTGGGCACTAG
GTCCACGCTTATCTTGCGCTCGCGCTGCTTGGGCTTCTTCTCCACAGGCTTCTTCGCAGCAGCCGCCGCAGCGTCAAAGCCGAAGAAGTCCAACTCGCTC
GCATTCGCATTCGTCGCGCGCTTCTTGCTGGCGTCTGTAGCACGCCACATGTTCACACACCATTCGCAAAGGATTAGTCAGCGACCTGCCTGCCACACAG
CGCTCTATACAAACAGCAAGATAGACCGAGAGAGAGGGTGTGACGCACCATCCTGCTTCTTGAAGATGCCGATCTCCTGCTCGAAGCGCTTCTTGTCGAA
CTTGGCGCCCTGTGTCAGCGTGCCGAAGAAGCTGCTCGCCATCCTGCTCGTCGTGCTCACTCACCGGTTGCTTCAATTGCTCTGGTGTTTGTTCAATGGC
CTTTTGGCTGGAGCAAGCGAACCAGTCAGAGCAAATAGAAGGACTACTGTACATACCCTCAATACTGGACCAGCTGGATTAAACTACCGAAAATCTACAA
ATATTGACACATATTTGAAACCAAAAAATGCTTCACCAAAACGAATGATGGAAATGGTGGGCTTGGACAAACAAGCAATTGGATTTCTCGTTCAACATTC
CTGCATATGCCAAGCGTCATATCAAACTACCCCAGTTTGACGTCTTGTCAGCATCGTCTTGCCTCTGTCTATCGTTGGATGCCCACGGGTCTCAATCGAA
GAACGTGTGCTTGGGCTGCGCAAGTGGGACCTTGATTTCCTCGTTCTCTTGAGTTTCAGATTCTGGAGAACCCCTTGACTCACCAGAAGCATCCTCAAGG
ACGGGAACGTGCTCTAGTGACGATCGAGCATCCGACCAGTGGTCGTTCACGCCGAGACTCACGGTGATCTTGGTGCAAAAGTCGTTGAGCGCCACGACGT
CGACAAAGTCGTACCGGAGCGACTTGATCCCATTCTTTTTCCACGTGCGCGCGTGCTCTTTTAAGAGTTCTCTTTTGACCTGAACAACACAAAGGACATA
TAACAGCCGCATTACCATACCATGGGTATGACATTCGCTGAACTCTAGTGACGAGATATTGGAGTGTAGTATACTTACCGTGCATTTCCACTTGGTGCTC
CGCAGTGTATCGAGCTTTTCTTGCAGTCCCATCTCTTCCAAGTCTGCGATCGTGCCGCTACAGACCAAAGCAAATGGCGTTGCGCTTAGAAAGTCC