Description :
From Genome Similarity Track
Location :
Scaffold_374:1- 3890
Sequence
3889 bases(100 bases per row)
AGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCTATAACTCTTGCAATACAGGAGGAGTTTAGCCT
GCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACT
GCTGGGCCCCAGCAGTCGCAAGGAAACAATGTGCAATGCTACCGATGCGGTAGAATCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGG
GTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTC
GACCTTGGACACGCGACACTGAGGGCGGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGA
ACTCGATGAGAGCAAGCGGCTCTTTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGA
TTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGTCCGAGAAGCGCATGATACGCGTGCGCTTCACGTATGAAGTC
AAAAGTTTGTCGAGACCTTTATCGTCCTGGATTTTGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCCGGTCATCGATTG
GGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTACGCGCGACTCACCA
CTCGAGACGGCGCCTAATGCCGCTGTCCTGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAACAGCCAGCGTCGGCGTCGCCGCCGACGGCTGAAG
GAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAATCTCCGACCTCAAGGGGCACGGATGACGCAGACGAGTCACACGC
CTCAGCCGTGGAGGCTAACGCGAATCTGATTGGATCAGGTCTGGCCAAAACTAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTG
GGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTAGCCGACGC
TGCAGGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTACACGACGAAGAGCCGGGCGACCAAGCCGGG
CTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTAAAGAAGAACACTCGTCCATGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCG
GGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGC
TGAGAAGCCGGACGTTGAGACGTTGAACGTCTTGACGGTACCTGTGCCGGTTCCGGTACAGGGAGATGACCCTCGCTANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCTTGGTCACGTACTTGTGCAAGTACGTGAAGGACTACGCGG
GCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGAC
TGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGAT
CACGAGGGCCGTGATCGTGTCGTCTACTACTAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGT
ACGCCCTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACACAGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACAT
CTCGCAACGGATGGCGAGATTGCTCTCATTCTTCGCAGAGTGTAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCG
CGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCG
CGTACGCGCACGACGCGGATGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGC
ACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACTCGGACCGCGTTGTCGTGGCCACTGACCATGACCTGCGACTCAGG
ATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTTTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATA
AATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTATGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGA
GTGTTGGCAGTCCATGTCTTTGGACTTCGTGCTCGGTCTTCCCCCCGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTGAGCAAGATG
GTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGATATTG
TGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGAGTCAACTTTCGATGTCGACTGCGGATCATCCGCAGACG
GACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGT
TTGCCATCAACAACTCGGTACATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTC