Description :
From Genome Similarity Track
Location :
Scaffold_2001:1- 3870
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_2001-abinit-gene-0.20Dual specificity mitogen-activated protein kinase kinase
Pytiw_DAOMBR242034maker-piw_contig_2001-fgenesh-gene-0.1Alpha-taxilin

Sequence
3869 bases(100 bases per row)
TCCAGTTGGAAATTGTACCTTGACTGATGAGAAGCTTTCATCTCATTTTGTGTCGACGATTTGTGATTTGTAGGATGTTCCTGTTTACGGGCGAGGGCAG
CGCAGACAAATGGTGCGCGAACTTCACGCACTATACTCGAATCTTGTGCCGATCAGCGAACACGGTGCTCAAGCAGCTTCCAGACCATTGTAAGCTTGTT
CGACAGTTGCGATCTGTCCAGTCTTGCAAGTTTTCTAACATTGTTGGTACTTGTGGTTTCTGCAGACCGAGTCCGTATATCGTTTCGTTCTACGACGCCT
TCGTTGACCGACCGAAGAACTCGATCTGTTTGGTGATGGAGTACATGAGCACCGGGTCTCTCCAAGACATCGTCTTGCGTGGCGGGTGCCAAAACGAGAA
GATCCTAGCACGACTCGCTGTGGGCGTGCTCCGAGGGCTCGCGCACATTCACAAGAAGAACATGATCCACCGAGATATCAAACCGCACAACCTGTTGACG
AATCGCCAAGGAGAAGTCAAGATCTCCGATTTTGGGCTCGCGCGAACGCTCAACGACAACCTGAGCTCCGCGAAGACGTTTGTCGGAACTCTGCTCTACA
TGGCTCCGGAGCGGATCGGCGGAGGGGATTATTCCTATCCAGGTACGCTGAGTTATCATCCTACGATTCAAGCGACAAATTCAGAGGCTTACTCACATGT
TGTCGTTGTGTATTCCAGCTGATATCTGGTCGTTCGGGCTTGCGTTAATCTCTGTCGCACTCGGAAAGTATCCGCTCCCGACTCAAGACGGATTTTTTGG
GCTGGTCGACTCAGTACGTCTGCATTATGCTATGGTCAGACCTATGAGTTTTTTTCTTTCTATTTGGTCACTGATCAGTGCGTTGCGCTTGAAATTGATC
TTGCAGGTCGCGAATGAGAAGTTCCTCGAGTTACCAGCAGATCTGTATTCTCCGGAATGCCGATCATTTATTCAAGAGGTTCGCACGATATCTCCTGCAG
TATTACGTCTTGCTGTTATTAACGATATTCCCCATTTGCTGAAAATGGTAGTGTCTGCGCATTGAACCGGACGAGCGCCCAACTGCGGAGGAGTTGCTGT
CGCATCCATTTATCTCCAAGTACTCGCCAGAGGAAACGCTGTCGGAAGTAAGACTCGGTCTGGACTCTTCATTCAATGCGCGATATCTGAACACTGATGG
TCTCTTGTGTCTGTAGTGGAAGACGTTCATCGAGGAGCAGTCGCTATGCGAAGAGCGCGCAGCTGAAGTGGATACGCTCGCAGAAGCTGTCTATCGACAC
ATCTACGAGCGATGCGTCAAGTTTTCGTTCCAGCCCCAGGTAAGTTCACCGGTTGTTTGTTTGCTGCCTTCTGCAGGCTTTTTAAGTAACTGACCTTTAT
ACTTGTTTGTGCTTTGCAGTCGGACTATGGCGTCTCGTTCCTCTCTCAGGCGGCCCCTGCGTTTTCCCGTCGCCAAATCTCCATCGAGCCTGTGCAAATG
AGGTGTGACTTGCTCTGTTTACTGTCCTATCTACCACACTTCTTCAATGTCTGATGCTGATCATGCTTGCTTCTGAACTAACTGCTACGTTTACGTAGCC
TTCAGCTGGGGTTGGCGAACGGCCTCGGACTGCCAGTTCACATAGTCTACGAGCACTTTGAAGCGGTAAGTGTGTGTGTGTGTGTATGTGCCGAGTAGCC
ATTTGGAGTGTCTTATGCTTACTGACAGAGTGGTTATCTGGTGGTGTGCTTTCTCAGAAACGCTCGTTTTACAGTGACAAATTGCTGGAAGACTACTGCT
ATTCGCCACAGAGCTGGACAGCGTCTCCTGGCGACGCCCGTCGACAGCAGCTCTTTGGTAGCGACACAGAGTCTCCCAACCGTTCGAACGAGCGACGGAA
AGGCTCGTTCTGGCGCAAACTCCAAGACGGCATGTCAAAGTTTGGCAGCAAACGGAAGAAGAAGGAACTGGAAGAAGCGTCGTCGCGGCGGAGATGATGC
CACCCATGTCCTTCATACCAAAGGTGGACAGCGGGTGTTCGTTCAGCGCTTTCTTTCTACCGCCTTCCGAGACACGGAGTATGAATGAATATCAGGAGTC
AATTAGTCGTTCAGCCCAGCCTCCTGCTGCTCAAGCGAACTTGTCGAGATCCACTCCAGTTCTCAAGTGGAGATCTCGACCATTTTGAAGAGTGGTGGTG
ATGTCGACAACCTTGTTGGCCGTGCTTAAGCGAGACGGACACTGCCAACAGAGCTATCATCACCAGCATATCATTCTCACAAGCAAGGTTAGTTCGCATG
GACAGGCATGCTGATCATGTCCATGACAGGACGACGCTTTATCGCAAAACAGCATGTCGCTCGAATGTATCCCAACAAAAACCTCTCATACTCGATTCCC
TCTGTATGCACGATCTATAATACCTGCATACTCATGCATTATCGCAGGTTCCAGATCTCAAAGCACCATCAAATAGCAAGACAAGATGGACATGCCACCG
CCAGCAGACGCGGCGCCGTCGCCCATGGAGCTCAAGCGGCCGAGCTTCCTGAGCTCACGACCGAGCGACAGCAGCAGGAACCTCAAACACAAGTCCAAGA
GCAAGCGCACAGCTCCAAATGCAGGCGCGGCCGGTGGGGACAGCGGTCTCTATGGGGACAACAGCAGCAGCAGCAGTGCGCCATCGGCGGACGCCAAGAG
CCACCACTCGCACCATCACCACCACCATCACGTGAGTCACCGCCGCGGCATGGGCAGCAGTGCGGGAACTGCTACCAACGCTGCGAACGCCGCCACCAAG
GGCGAAGAGGCGATGCGCGAGCTGCTCACGAGCAAGATCGCCGAGCTCCAGGTCGGCGGCGACGAGAACCTCGAGACGCCCATCGACCTCGCTGGTATGG
ATACGAGGCGGACGAAGCTTGTGGCATGGTCAATGCAATGCAACTGACATTGTTTACTATGTATATTAGGGATCTACTTGGACGAGACGCTGCCCGTGCA
GACCGTCGCGGCCATGAAGGGCGTGATGGAGGACGCCGAGCTCAGTGGCGACGAGAAAGCGCAGGCGCTCAGTGCGCAGGTCGAAAAGGCGGTGCGTACA
AGTTGTTTGTTATATCTTATAGAAGCCATCGTATGCGCTTGTGGGGAGTGTGACGAGAGTGCTGCTTGTGAGGAACAGAGCGAGGAGCTGGCGCAGATGC
AGCAGAAGATCAGCGAGCTCAACGCCAAGTGCATCCTACTCCGGCAGCGCAAGAACACCGGTACGAAGATTGCAATCGGAATTCGTTCAGTGAGATGTGT
GTAGAATGTTCACTTTTAATGAACCCATATATTTGTTGTTTGTGTTGTGTAGCAACAACGGAGCTCGTGAAGACGAGCACGACCAAGGCGAAGCTCGAGC
AGCTCTGTCGCGAGCTGCAGAAGCAGAACAAACTCATTGTGGTGCGCCGAAAGTGCTGCGATATATGGCTGGAGTGTGTGTTTGAGACTGAATTATTGGT
GGTGGTGCTGCCTTGCATTGTAGAGCGAGAGCCGCCGCATTGCCGATGAAGAGGATCGGAAACGGTACGTTTGAAAACTTATGCTGATCTGTGGGGCTCT
GTACTGACCACCTCTTTGCTTTTCAATGGACCAGTTGCGATCTGTCAGCCCAGTTCCAGAAGACTATTGAGGAGGTGAGTTTGAAAATGGACCAGCAGGG
GAAGGACTACGTGGCGTCGCTCCGAGAGAACGAGAGGTAGGACTTCGGCTTCTATCGAATGCTGCAGTCTCGCTTTGATACTAATTTCCAAAATTCGCAA
ACCATTATATGGTCTATCCACAGCCTCCATCAGAAGCTCAAGAGCATTCTCGAGCAATACACGGTGCGC