Description :
From Genome Similarity Track
Location :
Scaffold_1465:1- 3856
Sequence
3854 bases(100 bases per row)
ACGTCGGATGAGTCGTCATCGACTTGGGCAAGTATATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGTGCTTCAGCTT
GTTGCTCTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACACGTTCATGTTTCCTCTTCCATTT
CGGTCAGAATACTCCTTCTGTTTATCTTGGGCTTGCGCCATGGTGTCTCGCACCCTGCTGAGTATGTTCAGCCTGTCTTCGGCAAACGAGGACAGTTGCT
TCCACAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGCCTCGTAATGT
GAGCGGCACCTGAGGGTGGCGCAATCCGTTCAGGTAAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCATTATTGAGTGCGAACTCAACCATGGGCAAG
CGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGTTTGACGCGCTCCGTTTGGCCATCCGTCTACGGGCGGT
CCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCAGCCAGAACGTAGCTGCGAACCTTGGGTCTCGATCAGAGACAATGGTCTCGGG
CAGACTGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGCAATGTGGACCATCTTGCTCAGA
CGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCG
GCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCGGCTTCACGCGCTGGCACGTCTCACACGTACGGACGTAGGTGGCGACCCACTTGTACATATGACGC
CACCAAAACATCTGCAAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCACTGGATGGAACGTCGTGCGCCTCCATCAGGATGTCGTACTTGAGAT
CCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGACCCTATAGTGGAGCAAACCGTCAGCCCACTCATAGCGGTGCAGCCTTGCACGTTG
TCGGGGCGTGAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATGCGA
TCATACAGATCCGTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCATGAC
CAGCCACTCCCAGAGCATACCGCTGGGCGTGCTCACAGCCGTGAGTGGGATGTCGCTCTCGCGCATCAGGACCTGGTAGTATCCGTCCACCAGGCACGTC
CTCAAACTCCTTCACCAAGGGGTACACCGGGTCCCGGGGGTTCTTAAGAATCTCAGAGCCCATGCGCGACGCGCGCTGTCTCTGGAACTCCTCCAGGACT
GCCTGTTCCATGACCGAGGACGAGTTCAACTCGGCCGACGTGGACTCCGGTCGGAGGAGAACCAACTCTGCGATCTCCCCGGCCTTTAGCTCGGCCAAGA
AGTCCTCCATGGCGAGCTCCTCAAGGTTCAGCAACTCTGAAACCTCGGGCAGAGCTGTAAGCTCGACAGCTCCTGTCTTGACCCGACGACCGGTCACGCC
GTCGAAGATGTGATAACACTCTTCGGCGGCTGGAGCCTTGGCTGGAGGCTCGGAGTCGCTGGCGACTGGCGTCGTCGGCCACACGACTAGGCCCGGCTTA
CGACGTGACCATCAGGTGTCTTCGTCTCGTGGCGCCGCCTTGACGGCACCACCGATCTTCGCGATCTCGTGCGGAACTACGTTACCCGCCTTGTCCTTGA
GCGGAACTTGGTTACCCGCCTTGTTCTTGAGCGGAACTTGGTTACCCGCCTTGCTGGGTGGAACTATGTTACACACCTCGCCGTGTGGAACTTGGTTACC
CACACCAGGAGCGCTTCCAGCGACTCGCATCAGTTATGGTCTGAGTGACCTCCTGTGGAACTATGTTACCCACATCGGAAGCGCCTGCAGTGCCTTCCTC
ATCAGTTACGGTCTGAGTGACCTCGCGTGGAACTTGGTTATCCACGCCAACGCCAGCGGCGCCTTCTCCAGCAGCCCTTGCTGCCTGCGGTACTTCGTTA
CCCGCGTGTGGACCTACGTTACCCACCTGGTAGGTGCTGTCCGGCACCTCCACTCTCAGGCCTTGTCCGGCCCGGTCAGAGTCGTCGTCAGTCTCGACGG
ACCCCAAGAACTCATTAGACGCTGCTGCGCCCTGGTGGCCCTCGCGGGCGCCCCAGCTGCTGCCAGAGGTGGGAACATGACTCACCAAAGCTCTGTCAGA
GCGTGGGGGACGGCTGGCCCCGATGGCCTTGCCGCGCCAGTCGATCCAAGGCTC