Description :
From Genome Similarity Track
Location :
Scaffold_1526:1- 3809
Sequence
3808 bases(100 bases per row)
GATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCTAGCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCC
ATAGATGGGCCAGTTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTATCTT
CGTTGTGTCGATCCGCTCGATCCTGTATTGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCG
TCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAATGGTGTATCA
CCCCGAATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTG
CTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGC
TCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATG
GTCTGCGCAGTTCTAGACGCACTAGCTTGGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCA
ACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGAAATTCCCAGGTGACTCCCCTTCGATTGTAGGCCTGCCCTTGCCTGTCTC
ACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGA
TGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTC
TCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGGATTTGGCATCTTCCCGACTCAGGTCTC
GTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCCCGCTTCCTCGTTCTGTGCTTTAAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTC
CTCGAAGAATTTGGGGGTTGAATCCGATCCTTCCTCTGAACTTAGTGACAGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTC
TAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTG
GCATTCCAATCTCGCTTGACGTGCACCAACTCGTGATTCATCCAACCTTGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGC
AGTCAATCTCACCTCGCACCTGTCTGGAAAACCCCAAATTTTAAAAACCCCCCCCAAAAACACACCACCCTTTTTTGGGAAAATCTGTCCCTCTTTATTA
AAACCTCAATCTCAAACAGAATTCGCTTGTTAATTCGCCTCACATGAACGCTGAAGCTCCCCGCCATAATGGAATCTGGTCCGTACAACTCCCATCCGGG
CAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTC
GGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGA
CTCCCAGGATCTCGTCTTCCCCTTTCGAGCATTTCACAACCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGG
CCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAATACGCGCAGGAGCGC
GAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGTCGAAGGTGAATGGATGACAGATCCCCTCATGTTCTTGTTTC
AGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATAACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCC
TCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTG
GTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTTGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGG
ATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGAC
TGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAA
TCCCTCCTTGGAAACTCGATGACCTAAGTATTTCACCTTGTCCATCCCCCAATAGCTCTTTACCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCC
AGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAGCACGGACGGGGTTCCAG
GATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGATC
GTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATC
GCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGA
TTAGATGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATTTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTAC
CACTGGGGATGCCCACGGGGACGTTGAGAAAGTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACC
TTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCA
GATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGT
GGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAAACTTGCTCATCTTCCGTCTTC
GTAGGATC