Description :
From Genome Similarity Track
Location :
Scaffold_1565:1- 3785
Sequence
3784 bases(100 bases per row)
TCCCTTAGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCGCACTGATAGAGAGAT
TCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCC
TAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCATTTTTGGGTTCCGGTATT
CGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTGGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACG
GTGTATTGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAAAAACCGCTGGCCATGTCTAGAGAGCGGTACCAGAGTACTTTATCCAG
ATCTACCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCG
TTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGTAGCAGGCCCTTAATCAGATCCGATAGTTTTT
CTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGC
ATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTAATTATCA
TCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGTTCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGA
CTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCT
GGTATCAGGGAAACCACCAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGCCCGACAGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCA
GGCACTTTATCCAATGGAAAGCTTGGATCCACTTGTGAATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGAACCTGCGT
TATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAGCCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGT
TGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTC
TGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCA
GTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGATATTGTGATCGACCTGGTCCCTGGATTACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCA
CAGTTTCTCATGTTCCACCCACTTCAACCGATCTAGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGGTGTCTTATCCGCCCTTATGATCCTCATCTTC
GCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGTACCA
TGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGT
TCTCCCATTCGTACTGTACACGCCTTCACCAATCCCAGCACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCT
AGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCGTGGCTTGTCTGAACCACTTTCCTGGGGCAT
GGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAAGATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATC
TGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAG
ACTTCGGATCTGGCAAACTCATCCACTTGGCGCACACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGAATCTAGGGTCC
TGCTACCTGGATCTAGCGATGTCTTTATCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCTTGGTTT
AACATCTTCTCGGCCACCTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAAAATTCCTCCATCGGACACTTGCCGA
CGTCGTGAATCTCGCCACAGCCACGGCACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACATTTCTCACATACCAGATGTTTCCAGCATCC
AGATTCGGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACG
GTATCCCCCGGCCGCGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGT
CGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCC
GACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCCTCAAGCTCGTATGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCG
GCCAGATCCACGTCCCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGG
CCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTG
GGTCTGGAAACTGCGCAGCAAATCTGGTCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAG
GTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCG
TGAACCCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGTCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGG
GGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCC