Description :
From Genome Similarity Track
Location :
Scaffold_109:1- 3747
Transcript NameFunction/comments
Physo_142145putative polyprotein

Sequence
3746 bases(100 bases per row)
TGGAACCTCGGAGAAGACGGGAGGTCTTTGTGGTTCAGAGAAATTTCGGGACTGAGTCCTTACCCTATCCTATGCCCTAGCTACTGGCTACTCCGTACTA
CTGCTTGCTAAGCCGATCGTTCTGTGCCTATCCCTACTTCTGTCGTGCTTGCACTGCCGTCCTTCAACCTGATTTGCGTGGCGTAATCAAGATCTTACCT
CGACGCGTTTTAGTCGGCGCGTCTTACTCGGCGCGTCTTGCTCGGCGGGGATTAGGGTCGACGCGTTTTGCAGAGACGGGGCGCTGGTCGACTCGTCGGA
TGATTACGCGTCGAGTTGGACTCTGTCGCTGTGTCTCGCGGCCCATCACCCGCGTCGACTTTCCGTCGACCTCTGCCGCGCGTCGCCCCCATCAATCGCG
TCGCGTTTCATCAACTGCGTCGAGTTCATCATCCGCATCCATCAGCATTCGTCTCGGCGCCTTCTTTCACCGACGCCGACGTGCCCGCTTCCTCTCTGGG
CACTACACCACAGAAGGCTGCGGAGATGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCACGTTCAGGGTGCACCTGTTG
GGCTCTCAGTCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGTTTCATCTCTCGTAAAGGATGGCCCGCTGGCTGTCCTTCT
TCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGCCGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGTAAC
GACCGTGACTTCGTCATTACCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGAGTTTCAA
GACTCGGACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGACTGTTGTTCTACAACACCGGCCCGATGGATACTC
CCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTATTGCATCCTCTATGAGGTACACGACACGCCGCAGGCCGGCCATCTTGGCCGTGAGAAGACCTA
CAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGCACTTATGTGCGCACGTGTGAGACGTGTCAGCGAGTGAAGTCGTCCCCT
CATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCCCATCGGGCTGCTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGACGCGGCGGGCA
ACACAGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAACGGTACAGCAACGCTGTTCTT
GGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACAGGCAACTTCTGGAGCGCGGTCTTTGCGGTGGTT
GGCACCAAGCTGGACATGTCCACGGCGGACCGATGGTCAGACAGAGCGCGTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCTGAGACGCCG
AAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTC
ACCCCCGCCTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGATGGGGGAGGAGAAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAA
ACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGTGCGTGACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGTC
AGGGGCAGAGGCAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCAAAAAACTACCTACACATGCAGTGTCAGCCGTCTTCAAGACGAA
GTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTC
TACGTGAGCTTGCTCAAGCCGTACCAGGACCCGATGGAGGTGCAGATGGAGGCACCGAGGGTGACGAGGTCACAGGCACGGAGGTCGCAGGCGTCGAGGA
CGCGACCATCAACGCGGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCACGGGCACAGCGAGAGCCACAGGCGCAGGAGGCGCAGCAGTC
GGAGCCTGCATGCGGGCCAGGAGGTCGAGCTTACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCTCCCGGCCACGCTGCTCATCACGATCGC
AATAGCATCGCACCCAGCCCTACAGGGCCCCAAGGCGGTTCCAGCCCTCTCGAGGCACCTCGATCCATTGCGTCCGCTCGGCGAGCTGGTCGAGTTCAGT
GGCAGTCCGGCCCAGACGCGCATCAACGTCATGGATGTGATCCCGAAGGCGGCCCGCCTGCTGCCGCGTCTCCAAGAGCTCATCTTGAGTCGCAAAGGGC
CCCACAGCGGCCTCCACCGGCTCTGCTCGATGAGCATGGGAATCGGCATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAG
TATCTGGTGAAATGGCGAGGGTACCCTCACTCCGACAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGTGGACGCTTTTGATC
AGCTTGATCACCAGCGCCCCGAGGGCTCAAGGCCGGCACGCCGGTCGTCCCGCGATTCCCAGCAATAAGCTGGGGAGCTGCTGGGTCAGCCACTTTGCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGG
AGATGTCCCCAAGAGCGGACCCCGGCTGGAACCAAGTACCGAACGAGAGGCAAAGCCCAAGGGAGCGTAGAAGTGCCTCCGACTGGAGGCCGCCTGCTCT
TGGTGCACTGTACAACGCAAGAGGAGCCCGACCGGATCGAGTGAAGACCCAGAAACCGTGAAGCTGTCCAAGACATCCCGGACGTGAAGCCCAAGTGGAG
TGTGACCCCGTTTGGAGATAATCATGAATCCCGGATGGAGATACCAAGACACCAAGATACCATCCCAGATGTGAAGATCCAGTATACAAAGTCCAAGATG
TTTCCGACCGACCAAGCCGACCAGCCAAGATCTGTTCGGATCCCGTGGAACATTGAACTTCGCTTGCGTACCCAGTGATGATTATACTTGCTGGAAGTAT
GCTACGAGGGACCGCGGACGATTACGGCGACAAGACCATAGTGAAG