Description :
From Genome Similarity Track
Location :
Scaffold_1553:1- 3743
Sequence
3742 bases(100 bases per row)
CCTGCCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCA
CTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAG
TCGTTCGTTCTCCTGGGATCTAGCTTGCCGGAAGTATTTCTGGACTTAGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGA
ATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTCGGGCGGTGTTCATCGCGAAGGGGA
GCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTT
AGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGT
CTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGT
ATCCGGTAAACAGGTCCACCCAAATCTACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTA
AGTCGCTTGGATATTCCCAGGTGACTCCCCCTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACACTCTTG
AATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACAT
CCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATC
CACCGCGTAATCCGTAGCGATAATGCTGTAGGATCTGGCATCTTCCTACTCAGGTCTCGTACATCCCCTATCAGATACTTCTTAAGTCCTAGGATCCACG
CTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCT
AGTGACGGCAATCACCTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTC
TCCACTTCAACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCC
AGCCACGCAGGTGGATCATCACCTTCTGCCGTAACAGTGTTAGGGCCCGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTAACAAAATTTGATC
CCCAACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATTCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCTGC
GTAAGTGGATCTGACTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAA
CTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCGCAT
CCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAA
AGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCTCCCCACTAGC
AGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGG
TGACTGGATAGCAGATCCCCTCATGTTCTTGAACCAGAGCTGCTGAGACTGCCCAGTCACTGGCGTAAACTATTACCGTAGGTTGACGTTCCGGATCGAA
GTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCCCAGTTCCACGAATGCGTGTTGATCTCGGATCCACCGAGAAACTGCCTGTTCCATGTTCTGATCC
GTCGTCTCTATCCAGCCTGGATCCAGTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTC
GTGGATCCGGCATCTTCTGGGCTAGTGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATAC
CGCTGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACGAATCG
GCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCATCTTGCGCATCCCCCAATAGCTCTTTACCA
CACTAATAGAGAGATTCCACTTAGTACACGCCTCCTGTAAGGACGTCACTCTCTCGCACAGCTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGAT
GTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCACTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTT
TCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACT
CGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCA
GAGTACTTTATCCAGATCTTCTAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGA
CGTATATCCACCCCGTTCTTCTTAATGATGATTACCACCGGAGATGCCCGCGGGAACGTTGAGAAACGGATGATCTTGGCTTGCAGCAGGCCCTTAATCA
GATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGATCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGC
AGCGGGCGGTAACGCATTTCCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGAT
CCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCC
TTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATC