Description :
From Genome Similarity Track
Location :
Scaffold_1817:1- 3589
Sequence
3588 bases(100 bases per row)
TGCGATGGATTGCCTGTTCCCCACCAGGCCGGCTCGATTGCCCCGCAATCCGCCCCCTCTTTCAATCGGTTGTGCCCCCCCTTCCTCAACACCTGGTCCT
GTTTTCTAAAAATGGCAAGTGTTTTCTCGTTGAGACTATGCCGGATCGATCCAGCCCAATTTCCGCCCCCTCACCCGGCTTCTCCCTTCAAGCGGAACCG
GATGCCGTTTTCGACTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACCCCATATATGGGTTCACCCGAATACCGGAGCCCGAAAAGGGTGG
ATCCGGGGAAGACCATACGGAAGTGGATCCATTCGAAGCGGGGGATCCTGGCACCTCGTTTGTGTTAAGACGCTGATCTTACATCGACGACATTCTAATC
CCGGCGGAATCGTGGGATCAGCTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGG
GGATGCGCAAGGTGGATAACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGACTTGTCCTTCCCACA
GTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCCGCGGGTGTTGGTATGAATTTA
AGAGAGGTAGATTTTGCTGCGATGACCGCTCCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGAGATCCAAGT
GGTATGACGTCAGAAGAGGACCTAACACAGGAGCTGATCCACCCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGCCGGATCAGAACATGGA
AAAGGCAGAATCTCGGTGGTTCCGAGCTCAACACGCATTGCGGGGAAATGGAGGAACAGATTCGCGACCACGCCTTTTCTTGCTTCTTTTCTATTCGGAA
GCTTCCACCCTAGGGTAATCCTCTTATGCCCAGGGACTGGGGCATTCTCAGCAGTCTCGGGGGGACAGAAAACTGGAGGGGATCTGTCATTCCATTCACC
TTGGTCAACCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGC
TAGTGGGAAGATCCATCCAAATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGATTGCAAGGACGTTTGGGACAGTGGGCAGCTTT
ACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAAATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATAGAT
GAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTT
TCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGACAGATCCACTTACGC
AGAAGGCCTCACCGTCAATGAAGGCGGAGAAAATAAATGAAATTCTCTTCTGGGTTTGGGATTTAACTCAAGGGACACGATGTCGAGAAGGCTGGTGATT
TGTGGGGATTCCAATTTGGTAATCTCAGACAGCGTGCCAGGCGAGATTGACTGTCAGGCCCGGTCCTAACACTCGTTACGGCCAGAAGTGATGTATTCAC
TGCGCTGGATGTGTTGAATCACGCAGTTGGTGCATGTCAGCGAGATGGAATGCTCAGTGCAGACAGCTTGGCTCAGTGTCGCTTTACGAATCAATGTGGT
GTCGAAGTGGAGAGAGAAGCTCGGGCATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTAGTGGTTGGATCCGGGAAAAAGACAGTCCAGGTG
ATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGTATTGAGCGGATCCTCAAAGCAC
AAAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGAAAGATGCCAAATCCTACAGTATTATCGCTAC
GGATTACGCAGTGGATCTAAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAAGATCGGGATGGATTGATGAGACTGGTGATGCCAGAT
ACCTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCATCGGATCCGGGAATGTTTCCACT
GGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGAGAGTCACCTGGGAA
TATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGAT
TTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGTAGATTTGGAGCTA
GCGAGATGATTAGACATGATCGGGAGCCAGGCTATTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCAT
ATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGA
GTACGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCACATCCACC
CTGGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCAGCAAGCTAGATCCC
AGGTGAACGAACGACTGCGGAGTGCGATACAGGGTCGAGCGGATCGACACAGCGAAGATGCCCGTCCACATCAAATCAAGTGGGATCGCAGGTGTGGCTT
TATTTGGATCGCGTGAAAGAGGGGTATGCCCCGCAAATTAGCCCACCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAG
CTGGAAACGGTAGGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTT
CAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCTCCTACCGGACGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCTAAGTCGAGAGGAT
CACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGACTTTCTGGTGTATTTGCGTGGATATGACTAGCCCAGT