Description :
From Genome Similarity Track
Location :
Scaffold_235:1- 3550
Transcript NameFunction/comments
g13686.t1hypothetical protein

Sequence
3549 bases(100 bases per row)
TCGAGCACCGCTCGCAAATGATCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGTAT
ACGCCCGATGGGGCCGGAAAATCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTCGACAGCCCCTGGGGCGTCACCAACCACTCCCAGAGCATGCC
GCTCGGGGTGCTGACCGCTGTTAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCA
ACCATGTTGTTCTGGAGTACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGC
CGTTTGACTTTCTGACACAGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTTGCACGGAAGAACGCGTCAATGAC
GTCACACTGCTCCCTTGGCAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGG
CCAGAAGGCGGATCGTTGGAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCAC
TAAGCGCCTGCTTCGTGTCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAAGAGCGACCTCGGCTAATTCGCC
CGCCTTTAAGGTCTCGCCGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCAACC
TCGCCGGTCACCCCATTAACGAGTGTATATAGCTGTTCGCTATCCACTACTCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCA
CACGGCGTCGCTGTCGTCTCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGTTGCTT
CATCGGAGCGTCGACGTCAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCATTAGGG
CTGGGACCAGGATGCCTCGGCTCGCGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTTCGCCATCGTGGCGCTCACTGCTCAGCGGATAACGTGCCG
CTCCACGCGCATCATCAGGGCTATGCCCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCC
GCTCAGCGGATTATGTGCCGCTCCACGCACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGACGATGCCCAGCACG
TTGACCGTCTCGGTCCAGTGCTCGAGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGCTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAG
CGCCTAAGGTCTTAGACCTCCAATCAATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAG
ACAGCGTTCAACGCTATCAAAGTCCAGAAACTTCACGCCAAGGTTCACAGGTATCTTGGGCACCGTAACACGGGTTCCAGTCGCGAGACGGACAGTGATG
ATATCACTCGTACGCGCTACCAACGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATA
TCGTCCACGGCTTATCAAAGCTCTTCACGGTCGCTTCAACGACCAGCATGCCCGGCTTGCATACACGTTCCGTGTTGTAGAGCACGGTGCTCTTCGGGGA
TAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAAC
CAGGTTTCTGGTAAGAAGCTGGGCTTCGGCTCGCCGGAGCCTGGCGCTGCTTACGCAGCGGGCAACCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAA
GTACCGACGGATGCCGATGCGCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGGTCCATCGGCTCGGGTCCACCCGAGGAGCCG
GCGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAG
AGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCACGCCAGTGCGGAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGC
CATACCGGCAATAAGAGTTCGTAACTCTTGGACGAAGTCCACCAATTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGG
TTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGAGCTGTCCACCGATGTGGCACACGCTAGGGCCCACTCCCGGG
CCCGGCCATCCAGCTTGGACACGGCCAGCGCCACGCGCTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGATCTCTCTAATCCAGAGCAG
GAGATTACCTCCTTCCTTGCCCTCAAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGACGTAGACGCT
GTCACAGCCGTCATCTTCTGTTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTGGGGGCCTTGCGAAG
CAAGATGGGCCACACCTTCCGGGCCCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTCGGGCGTAAGTGGGCAAATTGCTCCATCCTCACAGA
GGGACAGTCGTAAGACTCAGGTGTAGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCGGAG
TCTTAGTTTGGTTGTAAACCTAGGTTCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGG
CTAATAGACACTAGACTTCAAAACGTGAACTGATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCAT
AGTGGAGCCTAGTAATATGCATGACGGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTACATACACCAACTTGGGTGTGCACACCATTTGTGTAAAAC
ACACTATTCGTGTACGATACACTAACGGGTACATGTAACCCCGTTACAA