Description :
From Genome Similarity Track
Location :
Scaffold_1700:1- 3539
Sequence
3537 bases(100 bases per row)
AGAAGTCTCGCGTGAGAAGCAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATG
GTCGTTGGGCACGACAACGCGGCCCGCGTTGTCGTCGACTGCACTATAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGC
TTCGGCAACTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGCAGT
GACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGTATCAGTCGTGGTGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCGACACAT
TGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGT
CCGCAGTGACGCGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCAGAACTTCGCGAGTGCGTACTTCATGGCAAGGTGCTCCTTG
TCATGCACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATC
CGATTGTGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGGCGGCCACCGCCAAGATCGGCGCCTCCGTCAAGCCCTGCTCACTGCATCG
CAGGCCTGCTGACACTCAACAGTCCAATTCCGCTCGGCGTCCTTCTTCAGGAACTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGC
ACAAGTACGTGGCCAAGCCAAGGAACCGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTTTCAGGGTCAGGGTGGAC
ACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCA
AGCAGCTTCCGGAGATGCGCCTTGTGCATCTCAACATCGCTTATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGT
CGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGTCGCT
CGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCACAGATCAAGAGCACTGTAGATAGTGCTCCTGGCC
ATCGAATCGATGATAACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTA
GCGGCAACAGGACCATCGCTCACTGTTCTGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCAAG
GCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACTATGCG
CTTCTCGGTCTTTACGATGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATTCTCGAAGTCAAGCCTTGATAGACTTCGCAGT
CGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCAT
CTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCC
CGCGCCTACTGGCGTCCAGCGTTTTTGTTTGGTTGCGACGGTGCCCGGAACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGC
AAAGTGACCGATTCTACCGCATCGGTAGCATCGCACA