Description :
From Genome Similarity Track
Location :
Scaffold_1887:1- 3524
Sequence
3523 bases(100 bases per row)
GAACTCCCTCATCAGTCGAAGAGACGGACACGGTCGTAGAGGACTCCAAGGAAGGCGCTGAGCGCAAGAAGTGGATCAGCGATCCTCCAAAGTTCTTCGG
GACCCCCTTCTATCCTGCGGTGAAGGAGTATGGAGGCGTTGTCTCGATAACTCCACCGATGGGCCTTGCTCCCGGATCGAGGCGTGTGTCATGAGATTGA
CCTAGATCCTTGAGACAAATGCTGCGTGACAAGGCAAGAGCCTCTGCCCAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCA
GGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAA
ATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGA
TGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCACTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGG
CTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATA
GTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGA
CAAGTGCGTCTTTGGCGTTGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGTCATCGTGGAC
TGGCCGGTTCCCAAAAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCAT
TATCCGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCT
TGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGCTGTGCTTTACTACAAGCAGACGCCGAAGTGCGTGAA
CGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAAT
TCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGC
AAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGTTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTAC
GAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTG
GGAGCGAAGAGTTTACAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATCGCGGCCTGCTGTACTACAGCAC
CGACTCTGAGGATAAACCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTA
GGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCAGCACCTATGTACGCACGTGTGAGACGTGTCAAC
GGACAAAGTCCGCGCCGCGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCC
CAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGT
ACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCGTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGT
CCCTCTTCAGAGTGCTTGGCACTCGTTTGGACATGTCCACAGCGGACCATCTGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATAT
CCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTAAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTAC
ACTCCGTTCTATGTAAACGGCTTGGCTAACCCTCGCGTCCCACTGACGCCTCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAG
CTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCCGAAAGCCA
AAACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGAGACCAAGTTTTATTAAACGCTAAAAACCTGCCTACT
CATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGTTTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCATC
CAAAGAAGATGCGCACGCATCCGGGCTTCTATGTTGGCTTGCTTAAGCCATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGC
TGGACCACGGACAGCTGCAGGGCAGCAAGTGGTAGAGCACACGGGAGGCTGAACGACAGCAAGTGGTGGATCCACAGATGGCTGATCTACAGCATGTGGC
AGAGCACAGGTCGCGGAGCGATAGTGCTCGAGATGCAGGAGCAAGGCAAGCTGAACGTTCAGCCGAGCAACTGGACGCTCAAGGTCCGAGACCTGGTGTG
GAGTCAACAGTGGTGGCTCTAACTATCCACAAGGTGGATCATCTCTTCGAGATCGACCGATGGGCGGTGAGCGTGAACGTTCGCGTCGTGGACGCCGGCG
TCGTATGGACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAG
CTCCACTTTCACGTGGAACGCCTTGTGGCGTGCGTAGACGCCAGGGTCGTACCCAGTACTTAGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATG
GGAGTTTGAGGTTATCCTCCGGCAAGATTGCCCTGACGTCGTTGACGCTTACGACCGGGCACATCATGTGCCGAAGCGTCGCCAGACGCTGGGCGCCTCC
CACTAGAGTGGGGAGCGATGAGG