Description :
From Genome Similarity Track
Location :
Scaffold_606:1- 3495
Sequence
3494 bases(100 bases per row)
GTGATCCATCCCCACGGTCCGACTGTTCTCGTTGGTTGTATTATCGTGGAGGTCAGCTCGCCGAGTTCCCCCAACTTCGATTCGAGCCATTCTGGTCTCC
CGCCGAGTTCACCCGATGGTCCGTGGTATTTTCGCTGTCATTGGCCACGCCGGTGTCTATGTAGTCGTTGGTTTCCGCTGAGTCGTAGCCTCCGGACTGG
TCCATATCATCCCACTCGTCTTCGGATTTGTATGGACTCGGTGGGTGCTGGTCGAGTAGGTCTTCCCCGTCAGAGTCTGAGTCAACGAAGGTGTCTTCCT
TGCGACTACGCTTCTCATCTCGACGTCCATCTCGGCTTTGATTTTGGCGAGGCTCGACACGTCGGCTTGGTGCTTTCCGCTTATTGTCTCGGTCTCGTGC
AGACACAAGTCGATCGCGCTGCTTCTTCCGCTTCTCACCGAGGATCCGACGATTGACTATCTGCTCCACCTTACCAATATATTCTAACTGTAAGGGGTAC
ATCAAATCCATCACGTCGTCATCTCCACAATGCAACAAGAAGTGCTCGACATGGTCAGCTGCGTCGGCGCCACCTTTCTCATACTGGATCTTGGCTGTCC
GAGCATACCCATTGAGTCGGATCAACAAGTCACAGATTGGCTCGTTGTCTTTGCGTCTCGCCGAGTAGTAGCGAGCGTGAGCGGACTGGTCAAACGGTGA
GTAATAGTAATCCAGGAACACCTCGCTGAGTAGTTTCCAGCGTCGCGAAGTCTTCTTCGGCAGTTGCCTATATTAACTCGGCCGCGCGTCCCAAGCATAG
CGAAAATGGTTCGCGCCAGGCACTTTGGGGCATCCTTGTGCTCTTCATCTCGTAGATAAAACGCTTTAGCCACTGAAGCGATGCGTCAGAACGGTAGCGT
TTGCCTTCGAGCTCGGCGATTTTGTCGAGTGAAGCGTGGGTCCGAACTTCCAGGTACTGAGTCGAGTCTTCTTCTGCCGCGTCGAAGCTCAGGTGTCTCC
TTTCAAATCGAACGGGTCATCGTCCTCTTCGTCCTCCTCGTGAGCTTCAGTTCCGTCTGCAGCGTCGTACAGCTCACGGTAGCGACCTGCATTCCGCTGT
CCACGACTCGGCGCTCGCTGAGTTAGGTTGATCTTCACCGGAGTCAGCATGTGGGAGTCTTCGAAGTATGGAGTGTCTGGCGTAGCGCGGAAAAATTCAC
GTCTCTTCGTCTCCGGGGTCTTCACCAAAGGAAGTGTGCATGGGTTTTCGCCGAGTGCCTTGAACTCGGCTACTCAGCTGTACACCGGCTTCGTTCCACC
TAGGACCTTCTCCAATCCAAACGCCACTCTCAACTTCTTCTTCCATAGCCATAGCTTAGCTCCGGCACGGGTTAGACTCCAATCCAATAGGATGGGGCTG
TTTGGTCGGCTGTTGCACCGATACCCCATCGCCTTTAGCAGCAACACAGTCTCTTCCATCAACTGATTGATGTTGGCTGCACGCACCGGCTGAGTTAGTT
CGGGACCCAACATCGGCCACTTCGCCTGCGTCATTGCCACAGGCGCGAACATCATCATCCACTCCGATCTCGTCCTAATCTCCTCGCCAAGTCGAGCCAA
CACTTTATTGGCGCTTGGCGTATCGACGCTCCGCGTCGCTTTCGGAATAAGTCGTGGACGGTTCCCTACAGCAACGCCATGTTCTTCTTCATCTTCTTCA
TCGTCCGCACCTTCGTCGAGATCGGCGGATAAGCTGCGCTCGACAGGACGGGGGCTCCCATGCGTCCAACCTGCAGCGTCAACTCTTCCACCCCGTCAAG
TAACTCGGCGGTAGTCTTCGTTTCTCCGAGCTCAGCGGTCTCGGGCTTTTCTTCATACTCTCCTTCACTAGCACCTCCGTTCTCGCTCTCCTGATCTTGG
CCATCCTCCTCGAACTGGATGGCTCGTCCCACCTCCATCGTCATGCGATGAGTCGTTGATCCGCCGGGTCCGACCCCGCGAGAGGCGATCCTCCAGCCGT
CGCTGGGCTTCCGTCGCTCGGAGTTGCTGATCCCTTGACCATCTTCACTCTTCTCTTTCTCTTCTCTTCCTCTTAACTTGGTTAGCTGGCACCTATAAAA
ACAAGCACACACTCCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTAGTAGAACACACAAATATCGTCAGATGTGGATTCCTTACACAAACCACAACGAA
TCGCCGAGTTAGGTCGGCGGTTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGCTTCCACCCGGTT
CCGACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTTCACCAAAGGATGGACGACGGCG
CGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCAGCTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTATGCGGGAC
TTTCTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTATTGACG
GCAGGCATAATCCAGCCCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGCAAATTCTGCTCTGTTATCTTCTGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCT
GGGTTATCAGACCGAGCCAATTCTTGATCTAAAGTAGGTTGACGTATGGTCGAATTTGGAAATCCCTACACCACACGAAACACTTCATGACACCTGCGTC
GGTGAACTCCATGTTCAGGTATGGAAGAGCCCACGGTGGCAAAGTGGACGAGGCCGGCACCGTAGGGCGAGCACCAGGCAACACGCGGTGAGGCAACGGC
TCAACCGACGGTGCGCCGCAACGACGCAGCACCTAAGTGTAGGTGGCCGTGATCTAGCGCCCGAGCCCGCATCGAGCGTTTGAGAAAACGGGCAAGGAGA
CGGTGGAGCAGAAGGAAAATATGGTGGCGCTTGTGAGCCTGGCGATGACGGAAAAGGTGGGCCACCGATTATGATTTGAGATGTTACCATTGGCGAAGGA
TTCGGCCGAAGCGGCGTCGGAGGCCGAGCAAGGCCAAGGCCACTCCAGTTGCCGTCGGAATCTTCAATATCTTCGTCATCAGCTCTATTCGAATGTTCGG
TAGGTGGCGGAACATCACCGCCTCCACTTGGACCATTAGGAGAATCATCCACCGAAAGTTCATCGTCATCCACGTCATCTCCGCGATCATCATC