Description :
From Genome Similarity Track
Location :
Scaffold_1890:1- 3468
Sequence
3467 bases(100 bases per row)
TTATCGATCAGGCGATAAGTAGATAGCGGGGTGCGTTCTTCAATACAAAACGGCATCCGGTGAAACTCAAAACAGTCCAAGCGGTGTAATGAATGTGGAT
ATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCAT
TGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTTTTCTTGATGATGAT
TACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTAGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGCTTTTCCCGGAACTGAGGTGCC
ACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCA
GCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTC
TGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTC
TTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTTTCTCGCCTGGCAGTCCTTCTATCTTCGAGGGTTCAGGTACCCTGGTATCAGGGAAACCAC
CAGTTGGATCCTGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGCTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGG
AGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTC
TGGGGATCGTCTCCCGTCCTGGATCCAACTTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTTGCGGAGTTGGATATGAAGGCCGAT
CCACCAAGGAGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCG
GCGTGATCCCACTGACGCATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCG
CTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTCTTTCATGTTCCA
CCAACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCATTATGATCCTCATCTTCGCTCCATACAACGGCCG
CCGCCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACCATGAAATCCATTCCAAGG
ATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGT
ATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGC
ACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCA
CGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCT
TGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAC
TCGTCCACTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGTTACCTGGATCTAGCG
ATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACT
TCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCAC
ACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTATGCTTCCG
GGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAG
TTGTCTCCTGTCTTCGCCGTTCGATCGTTGGATGCAGTGAGACAGACCCGACGGTAATTTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTC
CTGAGTCGGGCGCCGTGCCTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTG
GCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCC
AACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCCTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTA
GGTATTTCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCCACAGTACTGGGTCTGGAAACTGCGCA
GCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGC
ATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGACCTCCTTCAAGTCC
GATATAGCTGAGATCCGTACTCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGAT
CGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCC