Description :
From Genome Similarity Track
Location :
Scaffold_219:1- 33782
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.17Conserved gene of unknown function
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_219-abinit-gene-0.37RNA-binding protein (AFU_orthologue; AFUA_1G02510)
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.18Transmembrane anterior posterior transformation 1
Pytul_var.sporangiiferumsnap-pug3_contig_219-abinit-gene-0.49Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.13Radial spoke head 10 family protein
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.19Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.20Heat shock protein 40/ DnaJ domain containing protein
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.14Mediator complex subunit 4
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.15Protein phosphatase 2C
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.21GPI ethanolamine phosphate transferase
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.22Phosphatidylinositol glycan anchor biosynthesis, class N
Pytul_var.sporangiiferummaker-pug3_contig_219-fgenesh-gene-0.6Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_219-snap-gene-0.23Glycosyltransferase

Sequence
33780 bases(100 bases per row)
GCCGATGGAGCGAAAGAGGATGGGCGATCCGCAAATGAGCTAAAACGCTCCAGGGACGCGTACCATGTTGCACGAGCAAATTTCACGAGTGATAGACATT
CCGCGCCGCGCCGCGACGCATTGTTGGACACGAGACGCAGTGCAACTTCTCGCCAAATGGATCTGCTACTCATGTGCAAAGTTGCACACTCTTCGTATTT
GGTTCGTCATGATGATCTCCGATATCTTGTGCGTATCACAGCCACATGCTGTCGCTTTTCTTCGACTGTTTTACCTTCATCTTCTTTCGTTGGGTAGAGA
GAACTTGACTGTCTCACGCTCTCTTTCTTGAGCAGTTCTTGAAGCTTCTCAATGAACCCAGTCCAGCAAAAAGCCTTCAGCACTTCCTTGTATTCATGGG
CTTCGCTCTGTTTCAATAACGTCGACGCAAATGCTTTGCAAAGCGACGACAGCCGAGCGCGTGGTATGTGACAGAGCCCAACCTCCGAAGCACATGCGCG
CACCCCATAGCCGTTGTATTATAGCCTTTCAATGGTTTTACACAGATTCCAATGCGTCACTAGCGTCAGCTTCTCGCGAACTCGCAAACTCCCTCCGTGG
CAATGGCAGAACGAGCGCGATGAACCACCACGTATCATGTCTTCCGAGCATGCGCTGAAAGTTTCGCAGCAGCGATTGCCGACGCCCACACAACTGCGAC
GCTCCAAATGCAGCACCATGTCGTTTCTCTTTGGAACGTGATCGACGAATCGCAAACTCGATCGTCGTTTGCTGTGAGAATACGAGGTAGAGATGCCATA
TCCAGTACCCGAAGAGTACGACGCCCAGCGTACTCGTGACCAAGAACGAAAACAAGATCAGCACGTTTTGCAGCCGCTGTGCAAGATCCTGGACCAGCAC
ATTGCTGTTGTTGCGATTATAATACTTGAGTCTTTGCGTATGCAGCACGTGTCGAAATGGCTCCCACGAGATGCTCGACGCGTACATGCAACTGATCCAC
AGGTACATGAGCAGCAACCAAAAGAATCCTACGGATCATACACAGCAAATGATCACCCAATGAAACACGTGGGGAGCAGAACGACAGTGAACTCACTGTA
GTTGTACAAGCCGACGCAGTTGTTGATCCACGGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCACGCATGTGCGACACACGCGGCA
ATGGTGCGCCCGCTCGGGCTTCACATGCGCGCATTTCTTGCAGGTATCACCGTCGTGTGCTGTATCGGTGGCGGGGGCTCGTGCTGCTGGAATAGAGGTG
ACGTAGCCTGGATTGGACCACACAGCGAGCGAGTACTGCAGCAGCAGCTGCGCCATAAGCAACAAGCTCACGCCATAGTGGACACCAGGCCACGCCGCCC
ACGATGAAGACGCTGTATGCAGCGGCAGGAAGAGCGCAAAGTGCACGCAGCCGAGGGCCACGAGCAGGAAGTAGCCCACGCCCACGAAGAGCGGGCCAAT
GTCCATGGAGTAGTGAGCTTGTGATTTTGGCGGCCGCTCTGACTAGACAGAGTACCATAAATCTGAATAAAGTACCTAGTCGACAAGGTACAGTACTTAT
CTGTATTACACATGTACATGATCGTCCGGATACGGGCAGCTGACATGCATGCATGCGTAATGGATCCATGAACCTGATGAAAAACATGAGCCATGCGCAG
ACATGGCTGGTTAACACAGCAAGGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATAGCGGGTGGCTTATTCGTAATAACGCGATACTGGC
ATAACAGCACAAGTCGTCCGGTGCTGCTGCTATTACAGTATACGTGCATGAAGGCCATGTTTAAGAAGAGAGAAGACGACCGTTAGGTGGAAATGCCGCC
GTGATGTCGGAGTGTCGATCGAACACCGTAGAGGCCACTATTCGAGTCCTCCACTTCTTCTTTTGTATGAAGGGTCCACAAATCTTGCGCAATGCGACTT
TGATCACCACGTAGCTGGAGGAATCAGGTTCAAGATTATTCTCGACCATGTACAACTGAATGATGGTCAGGTAGTGTATACAGTCACCGTATACTTCTAT
ACACGCCACCTGTTCCGTTCGTCCACTCCTGTCCACCGCCGCTCCGCCCGGACGTCCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAAGTGCGCGCCGCGCGTACCTACCGCCCTACCTGTCGATTTGGTGCGGGGAAGCAAGCAAGACGCGCTCTTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGGCTCGGTGCTTCTTACGGTCTTTACGGTCTTACTCTACGCGCACGAGCGTCCGCTGTCGTCTCCACGC
GTCCCGTTATACGGCCTGCTGCGCATTTAGGAGGAGGAAGCAAACAAAAAAAGCGAACCCATTGCGGTGTGGCGTGCGAAAGTGGCGCGAAGGAGAAGAA
AGCGCGACGAGCAAGCTTTTTTCCTGGAATTTCTTGGGTCGGCTTTGTTGTATTCCCATCCATCAATCACGGCGGCTGCGAGGTATGTAGATTTGTACAT
GTTTCCATTGCGCTGTTTTTATTTTGAGGGACCTGATGGGGGGGAAAGAACGGCTCCGTTAGACGGCGGGACCAGAGTGAGTGATGGGGAGCGTTCTTTG
GTTCCGCTCTCTCTGCATGGAGGGGAGGAACTGGTCGACGGTTGAGGGGCGGAAGTGCTCAGACGCCAATTTGGTTTGATCCCCTCGAGTCACGCCACCT
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCTTACCGTCCTACGGGTGCCTGCCTGCCTACCTGCCCGTCCCTCCTCCTGTAGCTC
GCCGTTATATAGACATGCTGATCTAACGAACGGCTTGTGTTATGTGTGTGGCTCTCTACGGACAGTACGAAGGAGTAGCGACCTTATTGACGCGCTTATA
GCTTGAACACGTCGTACCAAGATCGGACGAGAAACGCGGAGCCCGTTTTTTTTGCTAGCAATATGGAGTTGGCGTCCCACCACCACCACCACACGGTCGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGTGTCGTCGTCATCGAGCACGTCC
AAGTCGGTGCTGTCGCCTCGCAACAACGAGGACCAGCGACTGCTGCGCACGGTGGACTCAGCGTCGTCCATGAACTCGACGGTGTATGAAGAAGACGAGC
AGCTCCACCGTCCCGGATCGGCGCCTCCGAATCTCAATTTCGAGTCGTCCAACTTTTTTGCGTTTGGCAACTCGCACACCTTCTTCTCGAACATGTACGT
CCCTTCCTGAGAATGAAAATCTTGTTGTTTTTGGATTTTCTCTGTAGGCAAGTATGCTTATTTATGTCTGTTTACTGTGGTTGCTTTTAGGAAATACGAC
GACGAACTTGCGTCTGGCGAATTCCCCGAAGAAATGTCGTCGCCCACGGGTAACAATGACATTTTGCCTGCCCACACGATCTCGCCAACGAACCAGGTGA
CCCACGACCAGCAGTCGGGACCGACCGCTGTTTCGCAAGGTTTTCAAGCGCAGCGCCGGTACACGAGCAACATTGTGGACACAAAGTCGAGCCATCGCCA
AAGCGGGATGCCAAACCATCGCAAGAACAGTATCGAGATGTTTTTGTCGCAGTCACCAAGTCAATCGCTTGGTGGCGATTTCCTGAAACTGAGCTTGGAC
GACCATAAGATGAGTCTGCAGGCGAATGAGCGAGGTGCTGGCGCGTCAAGCAGCGCATTTGCGTCGGGCCACTTCACGCTGAATCCTGTGCCAGAGTCAC
CCAAGAAGTATGGACGTGCGAACTTGGGACTTCGACCTCCGCAGCACCAGGAACGGTATGGAGCCGCCGACTTGCAGCAACCAGTCATGTCGCGCTCCAG
CAGCACGAGCAGCTACACGAACTATCAGTTGAGCCCTCGCATGGGCTCGGAGGACTCGTGGCACGGAAGTCAGGATGGTGGGCAGCGTGAACCATCTTCG
TATTACCAGGACCACTCCGGTCAAGATTACTATGGCGGTCAGCAATCGCAATATGGCAACATGAGTAGAGAGCAGCAGTACCACAGCCAGCGCCAGGACC
ACGGCATGTATCGTAGCAACAACCAAAGCTCGTATGGTGGCGGGTATGCGAACAATAGCCGCAACCAGATGGCGCAACCGAGCGGTCATTGGAATCCCAA
CATCGCGGTGCCATCCTCGGGACCAGCGTACAACAATGCAAGCAACGGAATGTACATGAACAACCAAATGCAGCAACAGCAAATGCACTACCCGTCTGGG
GCCCCTGTCGGCAGTATGCGAGGTGGCCATGGCAATCGCGGTGGAAGCAGTCGACACAGCATGGGTAATAGCCACGTGTACTCGCGCATGACGCCGCCAT
TGCCTGAGACTTCACCTCCTCACTCGCCTCGCAAGAACATGCAGCTCGGCATGGGACTCGGCGGGGGCAGCTCGATGGGGATGATGAAGCAGTGCAAGTT
TTTCCTGCAAGGCCACTGCCGAATGGGTGGCAAGTGCAAGTTTGCTCACCAAGCGGTGCCGAACCAGCACCACATGCCTCAGCACATGGGAGGACCCCAG
ATGAGTAACAATGGCCTGAATGCCGGTGGAGTGAATGTTGGTATGTACCAACAACCGCTGCAACTGTCTCCACAAGCGTCTCGTGGCCTCCCACACCACC
AGTCGATGCAAGGAGGCGACGATCACTTGCACTCGTTTGGTCGTCGAAATGGATACCGACAAGCCGATATGGGCAACGTAAGCAGTCTCAACACTGGAAG
CCTGAATGCGGTCGGCTCGCTAGGCGTTAGTTCGGCGCAAAGCTCTGGTCTTGGTGGAATCAATGGTTCTGGTTTGCTGACGCCAAGCGATCCCTCGGGC
CTGAGTGCGGCGCTGAGTGTCGAAGACATTCAAGGACGCGTGTTTGCGATGTCGAAAGATCAGAATGGGTGCCGTCTGCTCCAGGAACAGCTCGATTACG
AAGACCGTAAGGATCTGTGTGAAGTGATTTATCAGGAATCTTTGGATCATTTGGCGGAGATGATGGTCGATCCATTTGGCAACTACCTGTTTCAGAAGTT
GTTGGAGCGCGTGAGCGAGAAGAAGCGTTTGGCGATTATTCGCCGTGTGAGCTCGAATTTGGTCGCAGCTGCGCTGAACCTCCACGGTACGCGATCGGTG
CAAAAGGTTGTCGAGGTGTGTGCGACGTCGGCCGAAGTCATCGAAGATGGCACGTACGACGACCTGGACGATGATGCTGGCGAGCGACGACCAAATGGCG
TGCGTCGAACTGTGAACCTCCCGGATATCATTGTCGAAGCGCTTAAGGACGACGCGGTCCGTTTGTGTATCGACTCGAATGGCAACCATGTCATTCAACG
TGCCCTGCAATTCATGAAGCCTGAGTACAATCAGTTTGTGTTTGACGCGGTGTGCAAGGAGTGCACGACGGTGGGCACGCACCGTCACGGTTGCTGTGTG
CTGCAGCGCTGTCTGGATGCTGCGAACAAGCAGCAGAAGGCGGAAGTGATTGCGCAAGTGGAGAAGCAAGCCATGAAGCTGATGCAGGATCCGTACGGAA
ACTACGTGGTCCAGTACGTGTTGGATTCGTGCACGGCGGAAGAAGCGTATGGCGTGATCGTGAAGCCACTCGGCAACATTTTCGAGCTCTCGATCCAGAA
GTTTAGTTCGAATGTGATTGAGAAGTGTCTGGAGAAGGCACCAGAGCGTGTGCGTCAGAACTACATCAAGGAGCTGATCAATTGCCCCAAGATGAACAAG
ATGCTCCAGGACCAATTTGCCAACTACGTGGTGCAACGCGCGCTGTGCGTGTGCTCGGAAGAGCAGTGCCTGCAGTTGGTCAAGTCGATCCGTCCACATC
TGGCGATGATGAAGAACACTTCGGGTGGGCGACGCATCACGGCGCGCATCTTGAAGCGCTTCCCGAACATGGACATCAGTCTGGACATGGGCTTGTCGCC
AACGAGCGACGGCATGTACGACACGAATGGCAGTCACATGCAGCTGAGCCACTTGCCGCCGCCAGCATTGGGGTACGGTCACCATCACATGCACGCGAGC
AACGGGTACCCTCTCGCGCATCCTCAAATGCACGCGCAGCAGCTTCCATCGCACCATGGTGCTGCCGCCATGCACTCGCAGCAGCACATGGGGTACTCGC
AGAGCAACTACAATGGCTCTCAGCACGGAGGTCCCATGATGAACGATGGGAGTGGACTCGGTATGAACGCAGCGGGCACGAGTCGCGCGTAAGAAGTCCC
CCAAGCTCGCTTGATAGTGAAGAAGAGAGAGGAGACGCGGTATAAGTCAACTGAAGTTTGAATGGAAAATTGAAGAATGAAGAGGAGAAAGCGTGGCGCA
GAGACGACGACGACGGAGAGAAAGACAGAAAATTTTGCTTGTTTTGTAGATAGGTTGAGACGAGAGAAAAAAGAGGAACTTGATGGTAGCTTTTGTATCA
AAGAAGACGAGAAAAAGAGACGAGTGGCAAACAGAAAAACAAGCGAGAGTGAGTGAGTGAGCGGACAGGCCATGTACAAGTAAGCTGTATCAGTAAGTCC
CCTCAAGCACCACCAGCGGAGGAGGAGGAAGCAAGAAGAGAGAAAAAAAAACAGGAGCGTGTGCGTGAATAACAAGCAGCAAGTGCAACCGTTCGCTTGT
GTGTCAGCGCTGTTTGTTTGCGATGGCCAGCAGAACAGAGTTAACGAACAAAAAATGGAGATAACTTGAAAAAGAAGAAAAAGCTCGCGATAATATAACA
CCTTTCGTGGTCGATCTGATTCATATGGCAGGCAGGCGTGTGGTTGCTGGAGTCTAATGGGTAACAAAGTTAAAACTTGTAGCGCTGGATGGACTCGAGG
TGGCGGACCGCGCGTGGACTCTTTGGTCGCGTGTCGTCGAGTCGTCCGGACTTGCACGCGTAGATCATGAGCACGAGNNNNNNNNNNNNNNNNNNNNNGC
AGCGCCTTGAACGCCGCGAGGCACATGAAGAACGCGACAGTCATGAGCACGCCGCTCACGGACCCGAGTTCGAATNNNNNNNNNNNNNNNNGAGCGCCTT
CATGACCATGCGCAGCACGACGCACGCGAGTGGCAACGACACGAGACCGAGGCGTCTCGACACGTGGTGCGTGTGGTCCAGGATCGTGTCTTCGTTCTTC
CAGCCTGTAAGGTCGCGACAGAGGATCGTGATGAACTTGGAGTACACCGACGGCGGGATCTGGTTGAACTTCGTGATGAACGCATGCTTGAGCCAGTCGA
TGGTCATCTCGGCGGTCATCACCATCGTCTAACGGCGGCACATAACGACAGCAATCACGCATAACGAGGTGAGAATCTCAACAACAGTTATGGAAGGTGG
GCTGATCGTGTCTTCTTACGGTTCCGTAGGCCACGTCCTTGGCGTTCGACTGCAGCAGGATGAGCCCAATGATCAGCAAGAGCTTGAAGCGCTCGACAAT
ATCACTGCACGCGATCTGAAACAGGTTTTGTTCCTCAAACTTCTTGAACACGCAACTCTGCACACAGAGCAAATGATACAGCGGATGAAACACTATCAGC
CTTTCATCATATCCACACGATTTAGCACAAGCGAAAAGAAAAATAGCACGAGTTGCGTACCTTGAGTTCGGCAAAGTTGTTGGAAATGAGAAGCGTCAAG
AGTGACGTGTTACTCGAGTTGATCGCTACGTTGATCGTCACGACCTGCGCAAACAGCAGCAGCGAATGGAGCAGTGCATCGAAGTCAAGGAGAAACCATC
AAGCCATGCCATGCAGCAAACATGTAGGCAAAATATGCAAACTTCACGCAGCAACAATAGCAAAAGAGGATATCGACATAGATGATCGCGACCATAAAGT
CGAGAAACATGCGCGTCACGCGGCGCGGCTGGTACTTTGCCGTGTAGTAAAGCGAGTCGAGGATATCTTGGCCGAGCGACGAAAAGAGCCGATCGAAAAT
CTACACCCCACATACAGAAGAAAGGGTTATTAGGGCAATGTGTGCAAACAAACGAGCCACACACGCAAGCAGACCTCAATCATGGTGAAGAGCACGTAGA
GCTTGATCATGGCCTGGCCACGGATCGCGTGGTAGACGCGCGACATGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAGCGTGCCCACGAAGAT
GATGACAGCAACCATGAGGTCGTAGAAATGTGTGCGACGAAACACGCGCGTGTGGAACGATGACGTCACGGCGCAGCCGCACGCAAACAGGATGCGCAGC
GGCAGGTACGTGAACACGTACAGGAACGAGTCAAGCGCGAGGAACACGCCAAACGCAAAGAGCTGCTCGATATTGTACGGCACGACGAGGAAGTTTTGCA
CGCGCTCCTGGTGCATACCGTCAGTCTGCTTGATGTCGTGCACGCCAAAGATCTCCTTGTAAAAAAAGTCCGATAGTCGGAACGCGTGAGGTGGCGGCTG
CGGCGGCGCAGTCGCAGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGGCGTGTGATTCCTGAGCCAGCGTCGGTGTCACTGCCTTATCAT
CGCTCTTTACGCTGGCGGCCATGCGCGGACTCTGGTGGATCGCAGTCGATGCTGGAAGCGAGAAATCTGTCTGCACCTGCAGGTTGTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTGTGACCCATGGAGCGCGACTTCAACACATGAGCGT
CGTTCGGAGACGGGGGTGCAGTGAGGGATGTCACGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTCCCAT
TCGCACTGCCCATCACATCCACAGCTGCTACAGGGAGAGACAGTGAATGCGCGATACCATTCTTCACATCGTTATCCCCTATGTCGCCTGAGAGGAACCG
ACTNNNNNNNNNNGTCGGCGTCATGGGCGTCGGCGTCGCGGGCGTCGGTCTCGGAGACGTGGACGTCGTGGGGTTGCTCTTGCTGCGGCGCCGCAAGATG
GATTCGGAGCTGCTGTGGCGCTGCAGCACGCGGAAGTTCCCGGCGTCCGAGCCATCGATGGTGGTGGAGACAGCGCTNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCGCCCGCGAAGCTCTCGTCTTCGCCCGCAGTGCGCCCCATTGTCGTTGAGTGATGCTGACACAACAGTGAGAACGATCAAAACAATACCGGTATG
AATACCGGCATTTCAGAGCTAGCAATCGTTTCAGCCTTGAACGATGCATTCTCATCTCAAGATTCGATTATACACCTTCAAAGTCAAGCTGCAAACGTAA
GAGCTATATATTGTCTATATCGATGCCTGGATATGTTTATGTCGATACTTGAGTTATATAGAGCATGATGAAGTGCATGACAAGTGTGACCTTTCGGACG
CTAAGAGCACTTTGTGTGCATATGGCGATGATGGCGACAACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGAATGTCGTGCTCGGATATGAGGGTGAGACGCTGCAGCTGCCGTCGCTCGTGGACGTGCCCGTGTACCACGGCCAGGGGCGCCTCGTG
TTCCGCACGGGGTTCGTGTNNNNNNNNNNAGGATGCACGGCAAAGGCCGCATCGAGTGGAGCAACGGCGTCGTGTACGAAGGTGACTTTGTCGAGAACGA
GATGACCGGAACGGGTCAGTACTTGTGGCCGAACGGCAGCTCGTACTGCGGCGACATCGTCGCGGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGGCGACGATGATAATGGCGCTCCTCTCGACAGCTCTACGTCTGCCGAATCNNNNNNNNNNNNNNNN
NNNNNTGGAGATGCTGTCTGCACCACTGGATCCGCTACTGCATTTCACGTTCCATATCCAAGAAAACAACCGGGATGGCAGCCTAGAGAGTTTGCCTCAT
ATCGCGGCGCAGAGCAACGCACGGTACGAAGGCGCGTGGCATGAGGGACTCCCGCATGGACTCGGCGTGCTTGTGTACGACGACGTGAATAATGCGCGCT
ATGAAGGGCACTTTGTGCGCGGCAAGCGTGAGGGTCAGGGTCAGATGCAGTACGCGAGCGGCAACTTGTACTCAGGCCAGTGGGTAGACGACGCGAAGCA
CGGCTACGGCGTCATGATGTGGATGGGGAAGCCGTCGTCGTCTTCGTACGCATCTGATCCGCGTCTGCGTCCTCCGATCGGAGCTGCGGAGCCATTGCCA
CTGGTGCTGCATGAAGTGTATGAAGGGTACTGGGTGGATGACGTGCAGCACGGCTTTGGACGCCACATCTGGCTGCACACGAAGCAAAAGGAGAAGAACT
ATTATGAGGGTGAGTTTGCAAATGGGCTTCGTCACGGGATCGGCGCATTCCACTATGCGAATGGCTCGCGCTACGAGGGCGAGTGGAGGGAGAACGTGAA
AGAGGGCAACGGGATGTTCTTCTACGAAGACGGACGCGTATTCTACGGCGCGTTCCACCACGACCGATGTTTGGAGCCCTCGGCAGCGCACTCGATGGAG
TCTGCAGGCGTCACCACAAACGCGCAGGCGACTGGCAATAACACCGCGACAACTTCGGCAGCGTCATCGTCTGCGACTTCGCCAGCGCGCATCTTGCTGT
ATATTGACGAACTCTTGCCGCCGGAGAAGGAGGTACGCGAGAAAGCGAAAAAAGCTGTCGAGCACGCAGCATTACGGCTCAACACGGAGTTGCGTGCTCT
GTATCGCCACTACATGAAAGATACCGGTGCTCCTTCCTCGCCCAGTGACCCCGATGCATCGCAGGAAAGCGTCTTCCTCATGGAGATCTTTGAGAGTCGC
AAACTGCTCTCGGATTGTGGAATCCATATCAACAGCGGCCACGTGGAGCAACTTGTCTGTGAAATCCGCAGGGCTCAGCGCCAGAGCGCATCTTCTGCAG
CGTCCAATAACGTGCTCCCGTTTGTCGAAGAACTGGAATTGAAGAACAATCTCCCGAACGATGACTCCACTTGTGCGACTCTTGTGCCGCACGACCAGCT
TCTCCTCTATCGCGAGTTTGTCGAGATGCTCATCCGCATCGCATTTCGGCAGAAAACGCAAACCGACGGAGACGCGATCGGTACGTTCTCCCTTGCAGAC
GCGTTCACAGACATGTACGAACATATGATGCGGGAGCGGCTCGAGATGCAGCAGCTGCAGACGGATAGCTGGCTGGGAACCCTGCGAACTCAGTTGCACG
CCAAGGAGATGCAGCTCATCTTCAAAAAGCATCACGTGCTGCTGTATAAACTCTTCGGCGAGTGTGGGCGTTTGAGTCAAACAAACTGCAGTCGAGCCTC
GACTGAAGAGATCGAACAAAACGCCAAAGGAGAGGAAGAACATGCTCGATCATACCTGAACACCTCTACTGTCTCTGTACGTTCGCTGCTGGTCACGCTT
CGTCACCTGAATACGTCGGCAAACATTGGATTCTTTGACTCGCCTGAGTTCAGGCTTCGCGATGCACTTGGTGCTCTGGATCAACTGTTCACTGCACCAC
CAGCGACTCGCAAGGGCATTCGAAATGACGATGACGACAACACAAAGGACGATGACGACAAACAACATGGCTCGGCTGGTGGTCTGGACCCGTTCTTCAT
CGATACACAACTCGTATATTCAGAATTTCTAGATGCCCTCGCTAGTGTAATCTATGTGAAGCAACAACAAACGATATCATCGCCACAGCAGCAGACTGAG
GAGCCCGGAAGCTTACCACAGAAGGACAACACCCAGCAGCAGCTCCCGCTGTACGTGCTGCTCGATCAATTTCTGCAGAGTGTGAAGAACGTGTAAGTGC
ATGATACCTTAAGCGAGTCATTTTCTTTCGCCTTCAGTGCCATCGCTTCGCTTGGTTGCTCCATCTAAATTTCGACTTAAAACACACTCCCAACAGATCC
CATGACTTGCGCGTAGCGCGATGGGAGGTCGACAACTTGGTCGTCTTCAAATGTAGCTTCAAAAACTTTGCCATCATAGGCGTAGCGAACATACCTGTAC
ACAAAAACACAAAACAAACAAAAGCGCAATCAGCGTCACCGCACACGATTTACAGCACTTCCCAAATGATTGTTCACGTACAGCTTGGGCTTGTCAGCTG
CAAATGACAAGTCTTGGGTGTCTTGAACAGACTGGTCGTGGTCAATGCAAGGATTGTAAAATCCAAGGAGCCCAGCCTTCGACGTTCCATGGAGCGAAAG
CGACGAATCCTGCACAAAATGCCATAGAGCAAACACAATCAGACGAAAGTTCTATACTATACATATGAAGATACCTGCAAAGCCTTGAGACGCACCTTGA
CGAAAAATTGCAACGGAATCGTGACATCAACCCACTTTTGCTCCAGCAGTTCCGCTGCCGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCTTCACCCCGTCGTGCCTCATCTTCACTATCGCTTTCCGCACCGCCGCCGCTATACAGCGCATCCGAGTCCGCAATATCTCCCTGACGCTCACGT
GGATCCGGACTCGTTGGGTTCTTGCCGTACCGCGCAACCAAAATGACGAGTCCCTTCTTGTCTGCTTTCTGCTTTTCCTTCTCCATCTTTTTCTGTGCGC
ATTGCATCATGAGCTTCTGCTGCGCGATCGCGCACTGGCGCGCCGTCGTGAGATACTGCACTCGGACTTCACGCCGGTGCTCAAGCTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTCGCAGCGCAAAACGT
CGAAAACGCGGTCTGCGCAGAGAATGGCGACAAAAAGATCGGCATCACAAAGCGGACACTGCCCCGCGTAAAGCCAACACGCAGCGTCACTCCCGTTTTC
GCGAGCAACACACCAAGCGCAACCCGCGTGCGTCTCGAGATCTCGCGACTCGCACCTGCGACCAAGGACAAACCGCCAAATAGGCTCCCTCGAAGCGAGA
GCTTTACGGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGCCCTTGTTGACTGCCACCACCGC
AGTCGCTTGGTAGTTGCCAGCGTCGTTACTCAACGAAGCCGAAAGCCCGTCGCGCGTGCTCCACATCATAGCGCCATGAAGTTGCGGCGTGAGCAATTGG
TTCGCGCCGAACGAGATATCCAATCCGTTGTCGTCCAACTCGGGGATCAGCATGAACACCGTGTGTGGAGACACCGGCTGGCTAATCTGGCAGTGCAACT
TCGGCGTCCATCCGAGTTCATTCGAGACTATGAACGAGGGGGTGCTTGGATCGAACGACGTGTACGCCAGCTGAGTAGTAAAGCTGCCCATGCCAAGCCC
ATGCTTGTCGTACATGTATCCGCCAAGCGTCAAGTTCAAGTTGCGGGTCAACGGGAACATCGTGCGCTGGTGGATCGTCATCTCCGTGCGCTCCACGTAG
CGTCCACCACGGTGGAACATGCTACGCAACCCGCGGATAGGGTCGGCAACGAAATCCGACGCGTCCACATTCATTGACATTTCGCTGAAAGACGAGAACT
GACCTTCGAGAGCCTGCGTGTTCATTCGACGGATCACATCCTCAACATGGCGTTGCATCTACAACACATATCACCAGTCAGTGGACGCTCGTGGCATACA
CACAACGCAATGTTACAAACCTCTTCGGGCGACTTCAAATGCGCGCCAACAACGTTGTGCAACGCCGCATCTTGCTCCAACGCTTGAACGCCCTTTTAAC
AATCACAAGGGCAACACACATCGAAGTATGCACGCATTAGTCTCTCAAACAGCAGCCACATATATTTTGCAGATGCAGTAGAGATACGCACTCGCTCGCC
GTAGAGATTGTACACGCGGCGCTTCACTGGGTCACACAGCACTTTGTAGGCGCGATCCAGGATCGGATATTGCGTGTTTGCGAGCGCGATGAGCGCCTCG
TCCTGCTNNNNNNNNNNCTTGCGGCGACGGTCTGGGTGGAACTCGCGCGAGAGCGCCAGATACCGACTGCGGATCTCGTCGCTCGTGGCGTCGCGGGAGA
CGCCCAGCAGCGCGTAGTAGTCGCGCTCAAACTGGCGCCAGAACGGGTCTTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGTCGTCCGCCATGGTCACCCGCTGGTTTGCTGCCACGGATTTTCACAACACAAATGGCGAGCTCTTGTCAGAGGAAGGTAA
ATAGTGCCCCCTCCTCCATTACAATTTTACATTTTCAGTAGATGCATATACCTAGTAAACGCATATTTAGGGTGGAACCCAATTTTTGAGCAACTTGTGC
TTCTTTTTGAGCATGAACCAAACCTGACGCCTTCCGTTTTTTCAGTAAATGCATAAAACCAAGTAGTCGCATGTAATCGATGCAGGCTACTGCTTTTATG
CAACAGAGTAGACGTCGCACTGCTATCTTGGTTGACTATCAAATTGGAAGGAAAATAACTTTATACAGATATCCGAAGTATTTGATGTGTAAATGCCTCA
TTATTAAATTTAGAGATCTATGAGCATGCACAAAGAGATCAATTGTACCCCCTCCTCCTATTTTTGCATTTTCGCTTTTTCCCACACTCGGCAAAAAGCG
AACGCAGGGACCAACATGCCGAGCGTGCGCGAAGACGTCGAAGTGTTTCTTCACGAGCACCGCTTCCTGGTCACGAAGCTCCTGGAGTCGCTCAGCACCG
CGTCGCTGTACGTGTCCTCGTCGCCTACGCTGTCGCTTCTTGCGTTTCTTGTAGTGTTACGCAGACGAGCTAACAATCGCTGAGTCTGCCATGAACTAAT
GGCGACCGCATGCTTTTCTTTTTTTTAATCTGCAGGCCGCCGTCGACGATCACTGCGACGCGATTGCGCACGGTGAACGAGACGTTCAACAAAGCGCTGG
AGAAAGATCGCGAATTGCTCGCGGCCGTGAAGAAGTGTACGTTGCATTTGGGTGATTATGTGGGTGCAGATGGTTGTGTTGTGTAACCATTTTTTCGCTC
AATGTTAGTGGCCCGCCACCAAGTCGCGCAGAAAGAACTTGCAAGCATTCAAGACGAAATTCAGAAAAAGAAGCAGAAAGTAGTTCGTTATGCCGCGCAA
CTGCGACGGTCCCAAGAGGTTTGTTTGTTTGGCTGGGTCGTGATGTTGAAGCTTGGTATCCTGGAGGAAACTGACGTGCCGAACCGTGTTGGCATCGTAG
GACATCGCTAACGTGCTGAAGAAACACCAGAATGTTCTCCAGAATGCCAAACAGAAAACCAAAGGTAGTGTTTTCTATCTGAAGAGGGAATGATCTGTTT
CTTGAAAAAAGTGGATATGCTAATATGTGGTTGGTGTTGTGAAACACAACAGTTGTACTAGATCCGCAGGACATTGTCGCGTACGCGCATCGTATCGCGG
GGACAACGTCTGCGCCAAAAGAGTGGCGTCCTGGCGTACGTTGTGTATTACACTTTTCATCGTTAGCTATAACAATCTCTTATCATCTTCCTTTTTCTTC
CCTCTGTAGTTCCCTATGTTTGGCTTCATGCCACCGGCACCGCAACCACATATGATGCGCGCAGGTGTACTCAGTCGTGGCATCGTTGCTGAGATTGTGA
CGCAGGAACCTGAGAAGTACTCGTCGACGTCGAGCAAAGTCAAGAAAGACGAGGACCTCGACAAGCTCAACATCCCTATTGGATTGGGCGCAAGTGATGC
GCAAATTAGAAAACAAATGCCNNNNNNNNNNNNNNNNNNNNAGGCTGGAATCCGGGCGACCCTGTGGATCTTCCTTTGGATGCGTTGCTCCATTACATGG
GGCGAAGCTTTTTCACGGTACTTATTGCTCGGGCAATGTATCGTCATCCTTGGCCGTGAAGAGGATGCTTACCCTTTTTTGTGATGTATTCTTTCGGTAG
GAACAAGGGATTACGTTGCCTGAGTCCTGGAAAACAGGAGACCCACTTCCACCTGATGCGATGGAGATTTTGCGAAAGAAGTTTAAACTTCCAGAAAAGC
GCGCACCATTGTACGAGGACGAAGTTGTCGACGACGTGGAAAGCCTGCGCAAGAAACGCAAGCTGGATTCCGAGGACGAAAGCGGTACTGCTACGGGTAA
CGAAACAGGCTCCGGGAAAGAGGACGATGAGAGTGACAGCGACAGCGATAGCAGTGACAGCGATTCCGATAAGGACACGACCCAGAAGATCTCGCTCAGT
CTTTCCTCGGACGATGACAGTGATGACGACGATAGTGATTGAAGCGTGGACTGAGGCAGCTGAAAAGACGACGCGCGCTTGGCGTAGCCATGTAAACACT
GCATACGAATGCAACTCTCTTCGTTCCGATGATCACGTTTACAATCCGAAGATGCATTTATGTTGTATATTCCTTGAGAATTGAGCTGACGAAATGTGAT
CAGATGTGGCTACGATCAGAAGATTTACCACTAGGTCATCCAGTGCAGCAAAAGGATAGATGGAGTTTCGAGCGAGGTCATGCAGAGCAGCAAGCGCAGA
ACCGTTTCGGTTTCTGGTAAGAGCCTCACAACGTTAGATCGATACGGCGTCTACCAAATGTTGCTGCTAAAACTCGGCATAAAGCAGACAAGAAGGTCCG
CGAGATCGCAAATGGTGGTCACAGACGAGTGAAGTGCGTGCGATCTCATCATGATCCTTGGTATAATTAGCATTGGTAAGTTCGCTATTTATGCGCTGAA
ACGATGCAAAATAGCCCATTTCCGATCTATCGAAGGTTTTTTTTGTCTTGTCGTGTGCCCCCTTCTTAGCGCTAAAGCACTGGTCATCAGGGCTTACTCA
CCAATGCAAATGCTTCTCCGTCTGATCACTGTCCACGCTTTTCCACCAGATTCCGCTGTCGCGAAAGCCGAGAGTACCACGAGGCAAAAATAGGTTTGCA
GGAAAGAAGCCACTACAGCCAGCTTTCAGGCATTCGTGCATTTGCGTCCGGCGTCCAGCAAGTTACCAACCACCACTTGTTGTGTCGCACATTTCACTCA
TTCGCTCTCCGCCTCTTCTCTTCATCGCAGTCTCCCAGTTCTAACGATGGCATTGCGTCAAGGAATCGCCAAGAGTGGCTCTGTCGCCAAAATCCGTCAG
CAAGAAGCCACGGCAGCCAATGTGGCATCACCAAAGGGCATCTCAAAGAAGACTCCGGGGATCTCGCCTTCGAAAGCTGGTATCAGTGACCACACGCTAG
GACTCCAGCGTCGACGCTTGTCCGTCGTGAGTGATAACAAGCTCGTCGAAGGCATGGCCCAGGTGTCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGATGTGGACTATGTTGAAGATGGCACGAGCGCAGTCGCTGCGTACGCCGGGTTGTCGAAGAAAGGCTACGCTCCNNNNNNNNNNACAACCC
GCGCAAGAAGAACCAGGATTCTATGATCATCAAGCATGACCCTGAGTCTCGATCGCTTTTGCTGTGTGTGTTTGACGGCCATGGAGAAGCCGGCGACGGT
GTATCCAACAGCATTCGTGATAAATACCCGACCGAATTGTTCAAGCACCCAAAGTTTGCGAGCTCTGGCAACTTGGCTGCAGACGCGGCAAATATCAAGA
CTGCGATCGGCGATTCGCTGCAAGTCGTCGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGACCCGTCGATAGACACGGAG
TTCAGTGGCACCACGGCTGTTGTTTCGGTTATTCGAGAGAATCTGCTGGTCGTGGGCAATGTAGGCGACTCGCGTATTACGAGAGGGTACGTTACGACTT
CGGCAAGCGGCGAAGAAGTGCTGGCGACTGAGTCTGTGTCGATTGACCACAAACCCGATCGCGCCGACGAGAAAGCGCGGATCGTCGCGAGTGGTGGACG
TGTGTTTGCGGTCGAGTACGATGATGGCATTGACGGTCCTCCGCGCGTCTGGTTGGGTCACATGGACGTCCCGGGGCTCGCGATGTCGCGGTCGCTGGGT
GACGCCGTGGCGCACACGGCGGGCGTGGTTTCGGAACCCGAGTACTTTACCCGCATGCTGGATGACAGTGACCGGTGTCTCGTGATCGCGACCGACGGAC
TCTGGGAGTTCATGTCGAACGAAGAGGTGATCGAGATCGTGATGGCGCAGAAGGACCCCAAGGTCGCCGTGGACCTGCTCATCATGGAGGCCAACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGAACATTAACGAGATGGTACCAGTTGCAGCCGTTGGTACCTT
CAGTGGAGGAGAAAGCACCGCTGTTACTGCAATGACGCCACCCCCAGCTCAAGTCGCAGCGTAGAAGGCACATGATCCAGCACAATCGCCTCAGTACGTG
ACTGATGACTATGTATTTTATTATCAATCCGCTTTCATCTTTCCCCATCTAATCTCATGGCGTACAAACCACGAAAACAGCCATAGCCCAGCACTATCGC
TGCAGTACGTTACCGATGGCGATGTATCTTATCTATCATTCTAAACTCACCAGCACAAAATACATGGCAAAGCTGTATATAAGCAAGCAAGGCACCTACC
AAAACCCCAGTGATTATGCTATCCGTGACATATTTACTCTTGCTTGTGAAGATTTGCATGACGAGTGGTGGCATCCTTAGCATCGGCAGAAAGTACGAGG
TCCCGCACGAGCACCTTGGCCGCGAGGAACAGCAGCGGCACGAACACGATGAGCGCGTTCACGATGCCGAACATCGAGATCGAGTTGCCGATTTCTTTCC
AGCTTCCTTCGTTTTTCACCAGAAACAGGAAATGCAGCGCCAGGATGTCCGACATTCCCACGACGAGCAGGAAATACCGCGATGGCGGGTGGCTGCCACC
GCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGAGCAGGAAAGGGATCAAGATCTTGATAACGAGCAGCGCGCCCATGAGGA
ACGGCGCAAACACCGTCACGAATCGGTACGTGGACGAGATCTCGAAGCTGCTCATGCTCGCGACGTTGCCCGTGCCGAAGAATGCGATCTTGATTAGCAG
CAAAAAGAAAAACGCGCGCCGGATCTCGTGCCAGAGCTGATAAGAAGCGATAGTAGTATTGCGACTCAGGTGCGCTTCGAGGGAGATCCAACTCACGAGC
ACGCAGCAGAGCGCGACGTAGAAAAACACTTCGTACGAGATACTCAACAAAATGTACGACGGGCTGAGCGCGAGCAAGACGTCAACCAAGCGCAGCATCA
TGGTACGTTCCTTGTTGCTTTCTCTCGGATCCCATGCCTCCACGCTTTGTGAAGTGCTCGACAGTTTCGTCGTCTTCGACGAAAGGCGCACAACGAGCAC
GATAATTGGAGCAATGGACACGATCCAATTGGCGACTGTGAGCACGAACGGTGGCTTGCGCTTGTCCTCGAGGTAGTTCATCGTCTGCTGCATCAGGATC
AACGACCCAAGGACGACGGCGGAGGATACGCCCCACTTTGCAAAAGTATTGCTGCTGCCTTCAGAACGGGTGACGAGAGATACGACAACGAGCGCGAACG
CGAGCAGGACGATGCCACCAGCGACGACCAGGAGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAACACCGAAATGAAGAGGCAA
CTGACCGTCCAATTTGTAAGCGTCAAGCTATTCGTGGATGAAGAAGGCATCGAGGTCTCGGCATCATCCTTGTTCGCGCCAAACGAGTCATCCACTAATG
GCCAGACACCCAAAAGCGTGAAGATCACGCCAAAGATGAACCGTCGCTCGTAGCCCAGTACAACCAGCTCCAAGCAGAGCAATACGAAGCCGCCTTCGAG
CCATCCCCGTATCCGCCACGCCTTGCTTCCCTCTGTCGTCGCTGTTCCACTCTTAGAAGGTGGTGCACGTAGCAAATGTCGGTGGTTCCACACGAAGTTC
CAAAATACCACAGGGAACGAGATGTACAGGAAATACGTCAGCGGCGAGCTCTCAAGCGTCAGGAACGTGAAGACACCGAATACGAGCAGCCAGAGCTTGA
CGTCGCTGGCTTTTACGAGAGAATTCACGTGAAATTGCGCCGGGTGCAAGAACGCAATCGCAATCACCGCGATCCAGCCGCTGTACCCCAGCACGATTAC
GCTGAGCAAGAAGAACCAATCGTACCGCTGAAAGTACTCGAGCGTCTCGAGGCAGATCGCGATCATTTCCTGGCTCAAGGCCTCTACTCGGTCAAAATCC
TGCGTATCCCAATACGCGCTCAATTGCTTTGAGACGCGCGGCAGCTTGTCTCGAAAGGCACGGAACGGCTTAAAGAACAGCAGCGTCTGCGCTTCTTTCT
CCTGCTCCTTGCGCAACGCGTGCATGTAGAGCTGCTGCGCGTTTGACATGACGGCCTTGGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGACAGAGTTGCGTGGGTATGGAATTCCGAGCAGCGAACTGATGAGCGGCGCGACGTCAGCTTGCATTACGTCCTTCC
GCGTAAGGTGCACGAGATTTCCCCACTCCTTTGCCGCAGCATCTTCTTGAATCTTTTGCGCATCCAATTGCGCCATCACGTCCGCTCTCGACTGCGTCGG
CAGGTCAATACGAAATTTAGGATCACGCTCATGAGAAGAAGTTGCCTTCACGGGTCCATCGACACCGGCGCCCCATGCGACGAGCGGCGTTCTCGTGTTC
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGTGAACACGTACGCGGT
CTTGCCGTCGTAGTCATAAAAGTCTTCCATGAGTCGGTAGACTTTCTCCACGAGCTCGNNNNNNNNNNGCAATGTTGTTTAAGTAATCGTTGGAGTTCGG
ACGATGCGCGTGGCCGTTCGTGTCGATGCCGAGGAAGTGGCAGAAAAAAATCAACTGAGGAGACCGCAGCTTCTGAGCCAGTGCGTCATCGATCGCTGCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCACTCGGTCGCGTGCGGCACGTGGCGCGCAAACATGGGCACAATATCAGGACTCCCAAAGAGCCACGAGTGCCGGCTCTGATTGAAGATCGA
GTCAAAGTCCACGGGGTTGTCCTGCCAGCCTTTCGTCACGGCACTCACATCCTCGTACATGCCGGCGAAGAGCGCCACATGACCCGGCCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGACCCCCCAGCTGCCCTGCGTCTCCACCATGCGGCGTAGGAACGCCACACGGCCCTCCTGTTTGTTGCCA
TCGTCGTTTCCCTGAAAGCTGGGGTTTTGCGTCGCGTTCACCTCGAAGAACTTGTCGGCGCGGCAGCCGTCGGCGACGAACACCACAAGCCGCTTGGCCG
GCGGCGGCAGCAGTGACGACGACGCCGGCGCGTGGTCGGCATAGCGCACGCTCTCGATGTGCGCCACCACGGGGGACTTGAAGTAGATGTCGAAGATGCT
GAGCACGTAGATCGCGTGGAAGACCACGCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACAATCTCTTGT
GTTGCTCTCGTTTTCGCTGGATTGCTGATGAGGAATTGGATAGGCATATGAAAAAGGGAGGCAAATAGTCCGTAGTTGACATTTTCGACAGTAGCCGGAC
GAGGCATTCATTTAGTTCAGTATATAAGTGCAATGTCCGGATATCCAGTCTGACCAGTGACAAGTGACCATCAACAGCGCCAACCGGTTAGTTACCTGAA
CCGAATTGCAGCTAGCTTTCTTACTAACCAGATGCCAGTCGCAGCTGGTTAGGTCAACAACTGTTTCTGATACTAACCGGCGTCGCCCACTGCCAAAAGA
ACAAAGGCGATAATCATCTTCAGTCTGTGTCTCGGTCACGGAAGCTGCCGCATCTCTCTCCTTTGCTTTACATACTTTACAAATTCTAGTTGATATCGCT
CCTTACGCCAGTACGTGAGCACACACGGCAGCATTTGTCTCGTTAGACATCGTGGTATGCAGGCTTCGTGTCCTTCCACGTTTGGCTGTTTCATAGCAAG
GGCACATGATCCGAGTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAATCGTAAGGATAAATGATAGACAAGCGCAGCCTTTGTGT
GAATCGCACGACCAACGTGTATCTGCAAATCTTGGTTCGTACCGCACCATCTATCCGTTAGACCTCGGTTTAAGTTCCCAACCCACCGTCTGCCTGTTTG
TTGTTCATGGGCGAGAAGTGGGCGAGCGCGGGAAAACGAGTCAAACAGCATGGAGATGAAGGCGCTCTTCGAGGCCGTGGAACTCGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGTGCACCACCAGACGCACCCAAAGCAGCCGCATGGAGACAGCGGACTCGCTG
TGTGTCTCGAGCCAACGCCCGTCGCGGTCACAGTATACGAGGCGCCGTCGCCGTCGACCATGCGCATCCACGACATCCTCAACAGCGAGCAAGACGACGA
CCGGACACTACAATCGACTCAGCGCCACACAGACGGTGGTGTGCATGCGTACAACCAGCACGCGCAGCAAGTGGCCCACATGCGCTTCCACTGGGATCAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACGGCAATGCCGACATGCCGAGACATGGTGGCGATGCTCGTGGCGCGCAGCATGAGGAGAACA
ATACTNNNNNNNNNNGTGTGCCGACGTGGTGGCTTGGTACAAGTACGACGACGAATGCGCCTGCGACGAACGCGACAATCCGCGACGAGGCGAGGAAACA
GAACAGTANNNNNNNNNNGCAGCAACCGCGTGGTGACGGGATCGGACCTAGCGGTAACGGTAGCATGGGGGCGCGATTGCTTTTGCTGAACGAGCGCGCG
GCACCACCACCAAGCAGCAGCATCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATCCGAGT
CGAGGCGGTATGCGCAAGAAGAATGCACCGATGGAGAACGTGCCCCGTACCCATCCGCCGCCAGTAGTGGCGCAATCACGTCCAAACCCACGTATATGGA
CACCAGAAGAAAAAGAAGCGTTTTGGAACGGATATCGAATTCATGGACCCAACTGGAAAGCGATCGAGACCGAGTTCGTGACCACGCGAACGGCGAAGCA
AATCTCAGCGTTCGCACGCAGAAGTGAATCGCTAGTCTCGGTAAAAGAGAAAACTCCTGCAAGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGAAAGTTATTGTTTCTACTGCTGCACCCAGCGATTTGATTGCCCGCGTTCCATCGTCACCCAAAGCAGCTTCTACGACGG
CACATCCTGCACAAGAAGCAGCGGTAGCACCACAGCAGGGCAGCTGCCAAGTACTTGACTTGAGTGAGCAGGCGGCGGCAGGAGACACAAGTTCTCAGCA
GAGACCTCAACGCGCCACGCGTCCATGGAAGAATCCAGTGCAGCAGCTCGCGGCGGACGAGAACGAGGGCCTCGCTGCCATCATTTCGTCGATGATCAAT
GCACCGGAGCCGCAGCAAAGAGATGCTCACGAAGCGGTGCCAACGGAGAGTGCAGCGAATGTGGCAGTGATGGTGAAACAAGTCACTGAGCAGCAGCAAA
CCAAGCCTCGACGCACCTCTCGTCAAGGGAAGAAGACGCTCAAAGCACGCGAATCAGAAGCGATGATGAACAACAACAACAATGCCGTGAACGCCAAGTC
CGTTGCTCCGCGCCTCGCATTCGAAGGCATTACCGTCGCAGATGATTCGCGGCATTCGTCGTCATCTGTGTCGTCTTGGACAGAAAACCACAGCGTGATT
GAGATTTTCACTGAAGAAGAGACGCCCGAGAAGAAAACAAAGCGCAGCAGCAAATTGCAGCAGGTCCCGATTCGGTCCAAGCGCAATGCGCAACGCCCGA
GTTGGGCAATGCAGTCTCCGATTCTACAGAAGAAGCCAAAGACCACCGACAAGAATGCTGTTGCAGGAGGACCAGCGAGGGGCAAGAAGCGGCGACAACG
GCCCGAGTTGGATGCCTCGGCTATTGTACCTGGCGATGGACGACCGTGCGACTTCTGCCACAAGACCCAGGGGGTTTGCGCGCTCATGCACTGCGCGGCG
TGCCGTCGCGCGTATCACGCCAAGTGCTTTGTGGGCCACTTTCGTCCGCATTGCAAAACACACGCGACAACAGAGAGTGAGGATGTCGTTCCGATTGAGC
AGCAGATCGCAGCGCTGCAGCTGAATCCACCGGACAATGTCCGCGTCACGATCTTTCGGTGTGGGCCGTGCCACGCGGCATTCATCGAGTTCTTCAACAG
CGGCGGCTACGAGTGGGACTGCGAGTGTCCGTCGTGCAAAGAGCCCGAGAAGCTCATTGCGTACCGGCGCCAGATGCTGCTGAAGATTATGTTGGATGAA
GACGACTCAAAGAAGAAGAAGAGCAATGGTGCAGCAGCAAGAAAGCAGGTAAAATCATCGGAAGATACGTATGCGGAAAACGCGCCCCAGGACACCAAGA
AGACGACAGCACGTGGTGGCGGTGGTGGGGCTACTCTTTTGCGACGAACAGGATCGCGACGTCGAGCAGCGCTCTCGTCGACTACAGCTGGCGACGAAAG
TGAAGCGATGATCGTGGATTCTGCTGAAGAGATCACAGTAGCAACAGTGCAGCTAGCAGAAGCCCAGGAGCGGAGATCCAAACCCTTGCGACGAGACGAA
CACGCTGCCAAAGCGAATGAGGACGGTGATGGCGATGATGCTGATGACGATGGTGCCGAACCAGAACAAGAAAATGACACGATCGACAAGGCTGGCGATA
GTGCAGAGACTCCTGCTGATGTGGAGCCAAAGCCAGAGCTTTCGGAGGACGAGCAGCTGTTGGCAGCCGTCACGATCAAGTTTGACAGCGGCCGCGACTG
CTTTGACATCGTGTGTGTGGTGGATACGAGCACAGGAGAGAGCATAAAGAAAACGGGTCTGTACTTTGTGAAACAGCGAGAGCTGCCGCCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGACGTTAACGAAGAAGAGCGTGAGCCCAAGGGCGAGAGCGTGTACTGCTATTGCTGCAGCAAGGACCTGACGCTGGCG
CAATTCGTGCGCCACAGCACGACTCCAACCCCGAGTACTTCGACTGGGTTCTTTACGGCCGATTCCCTTTTGCCGGAGGCAGCCGCTGCAATAGCGGATC
CGCGCGCATGCCTCTTTGTGTGCCATCATGACGGCATCGGATTGACGCCTTTGGTGAAGTTCTTGAACGTCTTGCAAAAAAGACAGCGTGCTGCTACAAC
TGCGGTGAGTGGATCGCCGGCCAAGAACAAAATGCAGCGAAAGCCGTCATTGTCAGATACGCTAGCCGAAGCGCGGCAGACTCTTACCGAAGCCGTGATC
TCTCGGCGTTACATGGCCACCAAGTCGCCGCGTAACGTGGCGCAGATGTATGCGATCAAGCTCGTGTGTCTGTCGAAGAAGCTTATGGTCCAGATGCCCG
ACAAAGTGATGCAGAGCACGATGGATCCGTCCATGCAGCTCGACTACCCGTACAAGGAAGGGTGGCTCTCGTTTGACGCTGGCATCACCCCTAGGAACGC
AGATAGCAAGCCACCGACGATGTCCACCGTGCAGTGCTCATGCTGCAAGCAGGATATGGCGCTGGACGCGTTCATCGTGCACACGAAACTCGAGGACTGG
AGCCCAAAGTTCAAGCGCCGATTCGTGCATGTGCCGCAAGTTGGCAACGAGCGGAAACTGGTGGAGCTCGAAAAAATCTGGCAGGCCGTGATCACGCTGT
ACCAGCATCGGCGCCTCAGCCAGGTCTTGCAGCAAAAGGTCCAAGCCATCGAACGATAAGCGCCAAGGCGAGTTTTTCCAAGATCTTTGCTGGAGAGAAC
ACGAGCCAGGTTGAGCACAAGAAGGGTAGTATTTAATAACAAGGGACGTGCTTGTGCTGCTGTGTGCTTTTGTAAGGATATTGTTTCTCCCTGTACTGCG
AGCAACCATCTACGTCGCAGAGTGGAATTGCCGCAAGCTGAATGGATCCCCTACCAGCCAAAAGCGAAAATGGACACAAAGCCAACATCTTCAGTTGCTT
GACATGTTGTTTGTGGTATATTTTTCTGTTTAGGAGAAGCATATCCAGAGCAAAAAGTTACATACACAAAAAAGATAGAAAGGGGACGACCCCACTCACG
GACACACTCACTCTTGTTTTTCTTCTCGCACATTCGTTGGCTTTCTAAGCATGGTTCATGTTGTTCATCGGCATGGGCGCGCCACCTGCCGGAGACTCGA
ACATTTGGTAATTGTTGCCACGGCTGCTGCCATTGTTGTTACCGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGTTGCGGGCGCTACCAGGGGTGCGCAGACCGCGACTCTCGGCACGAGCGCGCTGGGCCTTTTCGCGATCCACTTCGGCTTCACGCTTCGTACAGATCA
CACCATTCTTCTTCGTGCCAGCGCCGACCAGAAGAACCATCGTAACCAGACAGAAGCCAGCCAATGCGTACAAGTACAAGTACTCGTTCTTGGATAGTGA
TTCGTCTGCGTGCATGAACACGTACCCCAGCGGTGCAATGAAGAAGAGCGCAAAGAGGAACGTCGTTGACGAAGCACGGCCACGGGTGTTAAACATGCCA
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGTACATCAGCATGACAATCATACTGTAGTAC
AAGCCAGCGTTGCTCAGATCATTCAAAAAGCCAGAGCTCTCGTTGAAGCCCAAGACGCCAGCGCAGAGAGCTACTGGAATCAGCGTGCCAAATAGCACCG
ACTTGTGGTCCAGCTTGTCGATAAAGAAGAACGACAAGAAGGAACCAGTCAGCTGCAATGCCACCGAGTTCACAAACATGTGCGTTTCGTCTTTCAAGAT
GCTGGACGACGTCACCTCGGAGATCACAAAGGAGTTCAAGAAGCACGTAGACAGCGACGACACCAGCATCAGGAACACGCCGATCATAAACTTGAATGCA
TTGCCTCCGCCCTGATCATCGCCGGTTTCTTCTTCCCGAATGCTCTTCAACTCCTCAGAAACGTCAGGCTTGCGACGCAAAATCACTAAGCACGCTTCGC
ATGCCTCCCAGCCCTTTCGCTCCAAGAGCCAGAACGGACTTTCAGGGAAGATGTTCACAGCAGGAGTGATGATGGCGATCATTATGGAAGCACCAAACGC
TTGCCACACCCAGCCGAGCTCGTTCACGGACGAAAAGTACGCGTTCAGCAAGCTACCGAGCACAAAACCTGTACCAAGCATGAGGATCGATTTACCCCGC
ATATCCTTGGTCGCGATCTCGAAGATGTAGATGGCAAGCGAAGGCAGAAGAATACCAATCGAGCAACCGAGGAGACCAATACCGGGCAGCAGCAGCGTTT
TACGGAGGTCATCATCTGCGCAGACAGCTACCATACCAAGGGTACTGAAAAGACCACCCGTGACGATCGCCAAGCGGCGCCCGATGAAGTAGGTCAAACA
GCCCGACATGATCACTCCAAGCGTGCATGTACCGTAGACAATGTACGTCACTTTGCCATAATCACCGGTCAGAATTCCTTCGTAGGACGACACGTAACTC
GAGAAACTAGCAGATTGCTCAAGTGTGGACAGCAAAGTAAACAGCCAGCCACAGCCGGCGCCGCCCAGGAGACCCATAAACGTGGCCAAGGAGAACGCAT
ACTGGGACGACGCTGACATGACCTTCGAAAAACCTTCGTTGTACATCATACGAGTTTGAATAACGTTCAGGAACGGAATGCCCGACATGACGAACAAGGG
GATGATCATTGCCGTGCAGAACATAAAGTCGAACAAGAACGCCAGCTGCTGGAAGACAACGATGTTCGCGATCGACGAGTTGGCAAAACTCCACATTCGC
ATCGTTTCATTGATACCGTACAGTCCCGCGAAGTATCCGAAGAAAAGAGACATCGAGTACTTGAAGTCCTTGTCGAAGACGATCCACATCGCCAAGAAGT
ATGCCACGATAACAGCGAGCAAAATGATCAAGTAGAGCGCAGCACGGATTATAGGGCGAACCGATCTCATACCCAAACCAATCCCGTGAACGAATCCCAA
TAGTACAACGGTTGCCACTGCTGCACCAAAAGTGAAGGCAACGTACTTCACATCGGCTGTCTTCATCGTCGAGACATAGAACATGAGAATGAAATGACGA
CTCTCACGAAGCAGCACCGTAACACGCGAAATCATGTTGGAGTTGTGATATTCTTGAAGGTCTCCTTTCCACCAGGAAATCCATCCGCCTTTGTTCACCG
GGTCGTCGTCTTTGTAGTCTGCATCAGCAAACATCCAGGTCGCCCACGCTTTGATATCGACTTTTGTTTTCTCCCAATCCAAACCATCGGTATTGAACAA
GAATGGCCCAACGATCCACAGAATACAGATGAACCAAATCGAGAAAGTCTGCACGCCGTAGCCTTGAGCAGTTTTGCGAAATTCGAAGGCAAACATATCG
TCTCCAATTGGCGCATCGGTCTGACCGATGAAGAAATTGCCGAAAATCAAATACACGAGGCACAGACCCACCAATTCAAATGCTTTTCGGTAATGCGTAG
CTGAGTAGGATTTGTACAGCAGCACCAACGTTTCTCGTGTGATCTTGAAACCACGACCAGTCGCTTGATACTTGGCACCTCCGTGCAGAACGTTGTTGTC
GAAGTAGTGCATCGTAGTACCGACCTGGAAGACGAAGAATGCTGGGCCGAGAGTAATAATCATCGTGATGAATCGCTCCATACCTCTAATGAAACCACCT
TCGCCGAAGTAGACACACATCAACGGAAGCATGAGGAAATTACCGGCTTGGATGTAAAACTGAGTGTTCACCACAGCCTTCAGATCGGTGAGTACTCGGT
CGTCGAATCCATTGGCAACATTGTTCTTGATAAGATCCGTCGAGTTCATGCTGAAGATGATCTCCGATTGGACCCCCGAGAGAGCCATGTACACTTTGCA
GTACATGTACACAAAGGCCGTGACAATGGTCATCCACGTTGCGAAGTAAAAACCAGTGTGGGAGTAATACATCGAGTTGAGGCGGAAGAAGTCCAAAAAT
TGGCCCATACGATGAGCTTCACGCGCAAGAGACGTCTCACCCGCACCATTTGCCAATTTGCCTTCAAACGTCGAGATCTGAGAAAGAGCCACATCACGAC
CCTTGCCGCACTGCATAAATTCCACGTGCGTAACAATACCACCACGCAGGGTCGCATTGAAACCAGCAAACACATCTTCAGACAAGTTGATACTCTTACT
TGCTTTCGAGACACCGCCACGGCACAAAGCAATCACCTTGTCGAAAACATCGGGGTGACCATAGTGCATACGAACGCAGAGGGGGTCGGCGAGCACACGC
TGCGACAAGGTCACGAAAACAAGCTCTTGCCACGACTTGAATTTGGAAAGGGACGAAGCATTACCGGTAAAAATGTGCTCACGCATACCGATAATCGACA
CCGGTTTCTTCGATGGGTGCAGATCAGCCGTACGAAGGAAGTGGGGCATCTTAAGACACTCTTCAAAGTAGTGCTCTTGGTTCATATCGATGGTCTTGAG
GAACTCACCGCGACTGAACGGAAGCGCATTGTTCTGATTCTCTGGCTTGCCTTCACCAAGGATAGGATCACCTGGTAATTCGTACCGATACACTTCCGCA
ATTTCGTTGTTCTCACTCTTGATCAGCACAGAGTCAAATCGCTTGCTGCCACCCTCGACGGCAATGGTATCGACATACGCTACTCGCAGATTCGGGTACG
TCTTGAGAAGGTAATCGATATCGTCGGCTTGCACTTTGCCTTCCGCTCTGTGCTTACCATATACTTGACAGGCGCAAATGTACGAAAACTTCAAACGCAC
CATATCTTCCAGTTGTGCTTGCTTTTGCTCTGCGGTCTTTCCAGGACTCGACCCAATTTCCAACCAGTGCAGAATTTTAATAGCGTCTTCATAAAGCATC
ATACCTTGAACAGTACGAGCAAGTGTCTGACCTCGATATGATGCCCACAAACGAATCTCCATCGGGTAATTCGTTTGGGCCTCTTCAGCTGAGTTCACGT
CCACTCGTTCCAGGAAATTCTCCCACTCTTCTGGATGGATGGTGATAAGATACTTCAAAATGGTAATGTTCTTGCCATCTTCCTCGACCTTCTTGAAAAT
TGGGTGATTGGCAAGCGGATTGTTCAGTTCATCCAGCGCGTACAGCACACTTTCACTGTAAAACGGAGTCATAACGGAGAAAGAACGCATCTCCTTGATC
GCTTGCAGCTGCGGAATTTCCATGACCAAAGACTTCATAAAGAAACCCAGACGACGTTGTGCTTCAGGGACTCGCGGCATCGCATCGCTCTTTTCTAGGG
ACATCAACAAGTAGGCACGAGTAGCTGCGCCCATTGCTGTGTCGTTGTGGAAAAGGTTCACAAGTCCGCGAGAAGCGTACACGTACCCATTCGCACTGGA
GCAGAACTTCGAGTTCCCGAATTTAGCAGCGAGCTCAGGACGATTTGCAAAAATTCGGATCGCGTTCAGTAAGTTCTCCATTTTCGTGACAAAGTTGCGG
ACAACGCCCATAGTGTGAACACGGGATGATCTCAAATGAGACGATTGCGAGTCAGGGTCAGGGAGATCCATTACAGCTTCCAGAAATTCCATCGTGACGG
AGCGCAGTTGAGTCAAACTCTTCGAGTCGAAGGTCTTCATGAAGTTGCCGCCAGCAGCAACATCCTCAATCGTACGAAGAGCATCCAAAACGTCGGCGTC
GTCACTTCCGAGCAATGCCTCCATCACGTACATGCAAGCAGTGAAGAAGCTTCGAACAGCAGACAAGCAATCTTTCTTCATCATGTAGGCTTTCAACTGC
GAATCACCTTTTCCTTCTTTTGCCAATCGCACCGTGTATTCGATTGCCTCTGTCAATTTGCCAGCAGACAAGAACACAGGTTCGAAAACTTCGCCGGAGC
TCTGGATATCGTACTGCAAGATTGCTGCTTCCTTGTCGTCCACCAAATCGCTCTCGCGGAAAGAATTCACCACCTCATTCCAAACAACCACGAAGCGAAG
CATCATTTGAGACTGATAAGCAGCCGCAGAATTGTCGGCAGCGGCATCGTTGGAACGAGCAAGTGAAGTAACGATTTTCTGGTCAAAGAGTCGCGGAGCC
ACGCGAAATGCCTTGGTAATTTCCTTCACACCATGAATTTCTCCGGTTTTCATCCGTAAACCCTTGAAGTAACCAAGAAGCGCCTGGAAAACCGTGAAAT
AAATCTGGGTGTCGTAGTTGAAGATGAAGATGACCGGCATCCACAAAGCCATGATGTACGCCAAGTTGTGAAAAGAAATCACGTTACTGCTGTACGTCAG
CTTCATTGTGTAAATTGCCAACGATGGCGTCATCAACGGTCGAACCAGAATGAAGTACGAGATGAATGCCTTCAGTGACCATAGGATCAGCCAATACGTG
ATATACTTGACCTGGAAACTGAAAGGTGGAGCCATGTTTCGTCCGACGTAGCAAGATTCGCCTTCGCGGATGAACTTTGCCGCATACGTCTTGGTGACGA
TGTGAGGTACGAACGCTTGAGCGAGCAGCACGCACACACCAGGAGTTGCAAACGCTACCGCCGCGACCTGAGCACTATCCAAAAGTTCGGTATCTTGACC
TGTATTCAGCGGCTCGTAGATCATCCACCCGAACAAGGCGGCAAAGGCACCGTTCCAGATTAAACGGACTGTCAGCGCGCCGCCGTACGTCAACGACCGC
GAGGAGGATGCAGAAGATTCACGAGCAATCAACAGATGCCAGCCGTGAGCTGCTTCAAGCAAGCATTTAAACATTGCCATAGCCGAGTGCGAGAACACCA
AAGAGATCAATGCCAACTTCAAATCTCGCTTGGTGAAAGGGGCGACAACTTCTCCAAGAGTCTCGAATTGGGCAAACCACATTTTACCACCGCTCGGAGA
GATTGCGGACGCAAAACTGAGCACCAATAGGATGATGAAGAACATCATGTTGAACTGGAAAATACGGTAGTAGTTCACCACCAGCGTGAAGATACTTCGA
TGCTCGTAGTACGTCTTGCCGTGGTTTGCTGTGAGCTCGTCACCGATTTTCGTGACGTCGATGGTCAAGCAGTGCTTTTTCCAAAAGTACTCGTTGATGT
CGTCGTAGTTGCGCACCTTGGTGTGCTCTAAATGCTTGCCGAGACTGTTCTTGCGTTGCATGTTGCTCGCTTCTTTCCAGACAGGGCGCACGACTTGGCG
AAGGTACCATCCTTCATTCACTTTGTCTTCTCCGAGTGGGTCCTTGTTCAGCATAATCAGCATCTGGTGGTACAGGTAGCATAGGCACTCTGGCATGTGA
CGCAGGTTGCCTGCTTCGCCCCAAATCAGCAAGTACAGTAGAATCTCCATGTGTTTCACATTCTTCAGGTTGCCTTGGACCGGTCCCTTGTACGATTCCG
CGCTCACGCCAATAAACTGCACCCACTCGAGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTCGGACGGT
TTCGATCGCGCCTTGCCGTTCGCGAGCAGCAGCAGCACGTGCTCGCGCTGGTTGTCGACCGATCCGGACTGGAACCCAAACTTGTTGTACAGCACTTCGC
AGCAGTAGTCGATCGACACTTCGTCGTCAAAGTCGCCCTGGAGCCCGCCGCCGAGCTTGGCGTTCGGCTGCTNNNNNNNNNNNNCGTCCATCATCGAGAG
CCGCGTCGAGAACGTCTCGCGCGCATCGTGGCCGTTCTGGAACCGCGTCGAGTTGTTGCGCTTACGGTCGGCATCGAGCT