Description :
From Genome Similarity Track
Location :
Scaffold_630:1- 3352
Sequence
3351 bases(100 bases per row)
AAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAGCCCTA
AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
ACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC
CTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCCACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAA
ACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAA
CCCTAAACCCTAAACCCTAAACCCTAAACCCTACCAGCGGTTTAGCGGTTTAGCAAACCCTAGAAGTACCGTATTTTCTCCATAATATAATACCTGGTGA
ATCCGATCGATCAATTTCAGCAGGGTATGTGTTTTAATATTCAATTTTTCACGCCCAAAAACCTTGTAAAAATGATGCCCTGTCAAATCCGTTCATCATT
TTTGACAGGATATCAAGTTTCATAAAACTGTAAAGTAGCATACCTGTCAAATCCGATCAACAGTTTTGCCGGGTTTATTCGTTTCAATAGTTTTATTTTA
GTCATTTTCTACCCTTTCATAATTGATATCACCGTGGTAACTGATATCAGATATATCAGGATATCAGTATACACAGGTGCCCAGGCACTTAGTAATTTGA
CAGTGATGCAGACCGAAATTCGCAACTTTGAAACCGGCTTTGTATACTAAATCGACTACGCTGAGTTCGAATTCGTAAAAAAATCGAACTTTTTGAGGCT
CAGTTTCGAGATAACACGTTTTTTGCGTTTAATACAAACTTCCAGTCAACTTTTGAGGATGAAATTTTGGCTGCAACTCTAACTCACGTGTTTACATATG
TGTGCAAATTTTCAGAAGATTCCTGAGGCTAGTTTTTCCAGGGACCCCTCTACTAACGGTTCTCGACAGTACCGTATCTTCTCCATAATATAATACCTGT
CGAATCCGATCAATCGGTTTCACAAGGGTATTTGTTTTAATATTCATTTTGTCATGTCCAAAAACCTTGTAAATATGATGCCCTGTCAAATCCGTTCATC
ATTTTTGACGGGATATCAACTTTCCTAAACCTGTAAATTAGCATACCTGTCAAATCAGATCAATCAGTTTCACCAGGGTATTCGTTTTAATTTTCATTTT
TTCATGGCAAAAAAAAACTTTTAAAAATGATGCCCTGTCAAATCTGCTCATCGTTTTTGACAGGATATCAAGTTTTATAAACCTGTAAATTAGCATACCT
GTCAAATCAGATCAACAGTTTTGCCGGGTTTATTCGTTTCAATAGGTTTATTTTGGTCCATTTTGACCCTTTCATAATTGATATGATCGTGGTAACTGAT
ATCAGCTATATCAGGATATCAATGTCCACAGGTGCACAGCCACTTACTAATTTGCCAGGACAAACGTTCATCCGGGCGGTAATATGCAAGATTCGATCTA
AAGATGCTCTTTAATTGTAGGTCAGCCTCCACTCCATACTTTCGCTAATTTGAACCAATCACAACACTGCAGCCTCCACTGGATTCCGTGTAGCCTCCAC
CGGATTCCATGTAAAACGTGCTGTTTAAATGTCAGTTATGCCATATAACTGTCATTTAGCCTCCACAGCCTCCACCGGATTCCAGTGCAGTGCACGTATT
CTGTATACAGTATTCCTCCTTCATATACATTTGCACCTATTCCCCCCAATCTAACATTCATAATTGTTTCTCTCTTTTTTTATTCACACCAACCTAACTA
ATTTATCAACACTAAAATCTTTCACTAACAATATCCTCATTCTAATCCTACATTTCACCTACTTCTACACAAACTGTTTCTTTACGTACCTACTTACCCA
CACACTTTCCCCACTCTCATACTATTACTCTTTTACCTACCTCTCCGCAAATTACTCTTTTTCTTACCATCCTCATCTACCCACAACGCTTTTACCTTCT
TCCTCACACACTCTCGCCATTCCCATACTACTATTCCTTTTACTTTACCACAATCTACTCTCTTATTTACCCCTCAGTAATGCACCCTCAACTATGTCTA
CTCTATCTTCTCACATACCCCCATTAACTGTTTGCCCTGCATCTACACACATACTGCTCATGTATCCCCCCTCAACGTTTCCCCTTAACCTTCGTACACA
CTCTCCTTATGTATCCACCCTAAAACTCTCCATTTCCACTATCACTTTTCATCCTCTACTTTCGGACACACACTCCTCATTCATTTTCCTTAAATGACGT
CCACTTCATCTCAACACATACTACTCATACTGTTTTACTTTCAACTCTATCCTTCATCTCCACACACACACACACTCCATTCATTCATCCATCCATCCAT
CGAACCCCATACTACTCATACGTATCCACCCATAACCTCTTTTTTTCTCCACACACGCATATGCGGCGTTCGTCTACCTCAACCCTCTCCCCTCCACCTT
CACACGAACTCCTCATTCAACTACATCAACTACCTCCCCTCTTCAACACATACTGTTCATACTTGTCCACTCTCAATTCTTTATCCCCGACCTTTACGGA
TAAACTCCTCATTTGTCCACCCTCAACTATACCCCACCCCATCCATCTCAACACGTACTACTTATACGAACCCACTCTCCACACGCACACACTCCTCATT
CAGCCACCTTCAACTCTTTTCCCTCCATCTCCATACACACTTCTCACTCATCCGCCTCCCACTTCTTCCCCTCCAGTTCCACATACGTGCCACTCATACT
TTTCCACCCTCCACATTTTCTTCTCCATACACACACACACCATTCATCAACACTCAACACTCAACTATTCCCCCTCCAAAGTACAGAGAGGCAAGTCTTT
GACACACGCGAGTTGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGCGTGT
GCCTCGTTGTCATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAG
GGCCACCCGCCCCGGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGAC