Description :
From Genome Similarity Track
Location :
Scaffold_592:1- 3349
Transcript NameFunction/comments
g11272.t1hypothetical protein

Sequence
3348 bases(100 bases per row)
CCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGG
TCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGA
TTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATG
TTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAA
TAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGC
GGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTG
ATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTC
TTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAG
GGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGT
GCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCC
TTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTT
TCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTCCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAA
CTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGA
GGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCT
GCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCAGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGT
CATGAACACATCAGGCTTGTCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATATGAGATGAGGGCAGA
ATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCTCGGCCTTGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTA
GCCCTTCGCCTGCTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCTGTATTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCAC
CCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTT
TGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCT
CCCCATACGGAAGCAGAAGAGGATACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGTAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATC
GCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGG
CGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTT
GCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGC
GAATTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACG
CCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACCTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACG
CTCGTATGTGTTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACA
GCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGG
ACGTAGGTCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCAAGTGCTTCTT
CCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACCATGCGTTCTTCGGCGCGTTCGTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTG
TTGCTCACGATCTGTTCTGCGCTCTTCAGTGCGATCCTGTACACTCCTGTGAAGCGCGCGAGAAGCACTATTGCGTTCACGCTCCGAGGCGTGGACCTCT
TCGTTCAGATTATGCCGACGTTCCTGCTGTGCGATCCGGTTTCGTTCTCGTACGTCCCGAAGCTGCTCGGCACGGAGTTGGGCTCGCCGGGCTAGCTTCC
GCTCCGCGTCACGCCGCCGCGCACTCTCCCGCTGAGAGTCGGTCATGTTACTTCGTCTGGAACGCGCTCGCTGCGCCTCCCTCATCCGACGTGGATTTGC
TTGTGGGTCAGTCGCCCTCTGCATTGGAGCACCTGCAGAGAGCTGGCT