Description :
From Genome Similarity Track
Location :
scaffold_220:1- 3341
Transcript NameFunction/comments
g5861.t1hypothetical protein

Sequence
3340 bases(100 bases per row)
CTTCGAAGGCTTGACTTCGAAGAGGCCGACACACCTCGCGGTGTGTTGGAGGTACGGCTGGCAACAGGTGCCACCGTAAGGACTGAGAAGCGCGTAGTCC
GTGTGCGCTTCTCATACAAACGAAGGACGTTTGTGGAAGATCTTATCGTCTTGGATCTAGACGGTAAGTTCGACTTGGTATTAGGCATGCCGTGGCTTGC
ACGGCATGACCCGGTGATCAACTGGGAGAAGCGTGCGCTTGTACGCTTCAACAGCATGGGCGCGACAGAGAGCGATGGCCCTATCAGTGCCGCACATGCA
CCTGCCGGTGCATGCGACTCCCCAGCTGAGGCAGCAGCAGCCGCCGCTGCCTCCGATCGCCGCCAGCGACCCTTGACGACTCCGGGAGTCGTTGAGAGAA
AATGTGTTTCGACTCAGAAATCTGAGTCTGAGCCGAAGGGTCGCCTGAGTGATCACGTGAACAAGGGTCACGTGAGTGAAGGTCATCTGAATGATGATCA
TCTGATTGATGATCATCTGAGTGAAGGTCACTTGAATGATGGTCTGATACCGGTATCAGTACCGGTATCGTTGGAGGTACTTCAAGCCTCCAAGGATCGC
GCCAACGACGTCGCGTCAGCTCCGGGAGCTGACGAAGCCAATAGAATTCCGGTTCAGGGAACCGATAGACGTGCGCCAGCTCCGGGAGCTGACGCCACAG
GCGCGGGTGCGTCGACTCCCTGAGTCGACGTCACAATCAAAGGGCCACTAGTTCAGGGAACTAGTGAAGGCACATCAGCTCTGGGAGCTGATGATGCATT
TGATCCATCAGCTCCGGGAGTTGATGGAGGCGCATTAGTTCCGGGAACTAATGACGCGGCAGGAGGTGCTGGCGGTTACAAACGTCCAGCACCAGAACAA
CCTGCGTGCAGCAGTGCTGCACGCGATGAGCGGCACACAAGCCGGGCTTGATTGTGCGAGTCAGCGAAAGACATCCGCTGACGACTATTGTGATAACGAC
CCGTCCAAGGCGAAGGCCCTTGGACGCGGAGCACCTGGAGCCGGGCTCCAGGGAAGAACTTCACGGCGCAAGCCACAGAAGCTGCGTGAGTCTCAGTCCG
GGACTGAGACGGGTGTATCTGCCGGGCAGACACCGAGTGTCGAGACGTTGAACGTCTTGACACGTACTGGTACTGGATTACAGTACCAGAAGATGCGGCT
AGAGAATTCGCCGACGTGTGCGTCGGCGTTGACCGCACTTCCAACTATGAGTTGGAAGCGCTTCGCGCGGGACTTGTACGATGGACGCATCGAACAAATT
TGCATCCTCTCAGACGTTGAGAGGGTAGAACGCGATGCCGAAGAGCTGAAGCAGCTCGTCGTCGATGGGATCACTGAGGGCGATGACCCCCTCAGTGCGA
AGACCAAGAAGCAGCGCTTCGAGGAGCAGAGTTGGGACTCGTTGAGGTCGAGTCCCTACTACGACATTCTGCGGGAGTACAAGGATGTACTCCCTGACGA
GATTCCTTCGGAGCTTCCGAAGGATAAGGGCGTACAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGC
GAACAGGTGCAAGCGATCGTCGACTTCTTTGAAAGTCGTCGTCTTGCAGGTCAAGTGCGGGAATCAAAGTCCCCGCACAGTGCCCCGGCGTTCTGTGTCA
AGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGATGATACCGGCGCAGACGCCGATACCGCGAAAAGATGTGATCAT
CGATTCGATGGCCTTGAGCACTATCTTCAGTGCTCTAGATCTACGTGATGGATTCTATCAAATCATCATGCGTGAGAGGAATAAACCTCTCACGGCGGTA
AGCACTCCAAGCGGTATGCTTTGGGAGTGGCTCGTCATGCCACAGGGACTTCAGAATGCCCCTGCGACGTTCAATAGATGCGTGACACATCTGTTGCGCT
CGGTGCGCGACTTCGCACCGAGCTACTTCGACGACGTGTTCGTCCACAGCCGGGCTGTGAATGGTAAGACGGACGTTGAGATGCACAGGGTGCATCTCCG
GAAGCTGCTAGAGCTTATGAGGAAGCATAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGAGCGAGATACCCGTGCTGGGGTGTCTCGTCGGG
AAGGACGGCGTGCGCCCTGACCCAGAGAAGGTCAGAGTGATCAATGAATGGCCCACGCCATCCAATGTGAAGGAACTGAAGCAGTTCCTTGGGCTCGCCA
CGTACTTGTGCAAGTACGTGGAGAACTACGCGGGCAAGATTCGCCCGCTGTCACAGCTTCTTAAGAAAGAAGCTGAGTGGATTTGGACCACCGAGTGCCA
AGGGGCATTCGATGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCAGTGGCTGATCAAGATCGACCATTCCACGTAGTGTGTGACGCATCCGAC
TTTGCAATCGGATGCGCATTGATGCAACACGATCACGAGGGGCGTGATCGTGTGGTCTACTATCAATCGCGTCAGCTGAAGCCAGCTGAGCGTAACTATC
CCGTACATAACAAAGAGCTCCTTGCCATGAAGTATGCACTCGCAAAGTTCCGGGTGTATCTACTTGGGAGTAGACCGTTCGTGGTCTATACAGACCACGC
ATCACTGCGGACGGCTATTAAGTCGCCGCACATCTCGCAACGTATGGCGAGATGGTTGTCCTTCTTCGCAGAGTACAACTTCCGGGTCGAGTACAAACCC
GGAAGACTCAACGTAGTGGCCGACGCGTTATCGCGTCGACCTGACAATGCGGAGACGGTCGACGTCAACGCTGTTGGCGTCGTGAGGACAAGTGTGCCGT
TGTCAACGTTGATTGACGACGTGAAGGGCGCGTATGCAAGAGATGCAGACGCGAAGGGGCTGCTGGAGTACCTCGCAGCACCTTATCTTCGGTCTCGTGT
ACATCGGTATCGTGTACACGAGGGGCTACTGTTGTACAGTGCAGTAGACGACAATGCGGACCGCATTGTCGTTCCGAATGATCATGATCTGCGATTGAGG
ATCATGTTCGAGTATCACGATGCCCCTACGGCAGGGCATCCGGGTCGTGAGAAGACATACACTCTTCTTGCGCGTGACTTCTACTGGCACCACCAGTACA
AGTGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGCGTGAAGCCTGCACCGTTCTCGCAGGCTCCTCTTCAGTCACTTCCGACTCCGTCGGA
GTGTTGGCAGTCCATGTCCTTGGACTTTGTCTTCGGTCTT