Description :
From Genome Similarity Track
Location :
Scaffold_185:1- 3332
Transcript NameFunction/comments
Phypl_g4897hypothetical protein

Sequence
3331 bases(100 bases per row)
acattctgctgctgaacgacggCGAAGTGATGTACCATGGACCTCGCGAGCAAGCCGTGCCGTACTTCGAGAGTCTGGGCTTCGTGTGTCCTCCAGACCG
GGACGTGGCTGACTATTTGTTGGACCTGGGCACGGACCAGCAGTACCAATACGAGCTGGCGAAGGCGAGCAACCTTGCCTCATTTTCAGTTCAGTCTCCT
CGGTTGGCGAGCGAATTCGCGGATTTGTTCCGTCAGTCCGCTATTCACGAGAACGTTGTGCGGGCGCTGGATGCGCAATGGAGTGATGCACGTTTACAAG
ATGCCGAGCAGCACCTGGTGACGATGCCGGAGTTTCGACAGTCCTTTTGGGCAGGAACCCTGACAGTGATGCGGCGGCAGATGCTTCTGGCGCTCCGTAA
CACTGCATTTATGCGAGTTCGTGCGTTGATGGTGGTGGTCATGGGACTCATCTACGGCAGCACCTTTTTCGGCTTCGACCCCACGAACGCGCAGGTGTCG
TTGGGTGTGTTGTACCAGACGACGATGTTTTTGGCAATGGGCCAGGCGTCCCAAACCCCAGTCTTTATCGCGGCACGTGAGATTTACTACAAGCACCGCC
GAGCGAACTTCTACCGCACGTCATCGTTTGCGATTGCGTGTCTGACGGCACTCgtgccttctgctgctgtggagtGCCTTGTCTTCAGTAGCTTCGTGTA
CTGGATGTGCGGCTTCGTCTCTGGAGTGGGCTACTTCCTGTTCTTCCTGCTTTGCATGATCCTGACCAACCTCGCATTGTGTGCGTGGTTTTTCACGTTG
ACGTCGATGGCCCCCAACTTCAATATTGCCAAGCCCTGCTccacgttctccatcgcgttttacgtcgtcttcgctggtTTCATCGTCCCGCGGAGCCAAA
TCCccgacttcttcatctggatTTACTGGATCAACCCTCTCGCTTGGTGCTTGCGCGCAGTGGCGGTCAACCAGTACCGCTCGCCCAAGTTTGACGTTTG
TGTGTACGATGGCGAAGACTACTGCTCTCAGTACAACATGACCATGGGCGAATACTCGTTGTCGCTCTACGATGTACCGTCAAATAAGGCGTGGGCCTGG
GCCGGGGTGTTGTTCCTGCTGTTCTCCATCGCGTTCTTTGTGATGGCAGGCAGCTTTATTCTCGAGCACAAGCGGTTCGACATCCCGGCAGCGACGGTGG
CGGTCGTCCCAACCTTtgatgaggacgaggaaaAGAACAAACTTGATGATGTTTCTGAAgaccaagagcagcagaatCACCGAGACGGAACTGCCAGCTA
CGTCATGGTTGCTACACCACGAGCGGCCTCTCACTCTCCAGTACAGGACGAGGAGACCCCTGCCGACATGGTTGTTGTGGACCTTCACGAAGAGCAGGCA
CGATTTGTACCTGTTGCCCTGGCATTCAAGGACCTCTGGTACTCGGTGTCTCTGCCCCACCACAGACACCAGTCCATCGACTTGCTCAAAGGTATTACCG
GCTATGCGCTACCTGGTACCATGACGGCCCTCATGGGATCATCAGGTGCTGGTAAGACTACGCTCATGGACGTGATCGCTGGTCGCAAGTCTGGAGGTAC
CATCAAGGGCGAGATTCTCCTGAACGGGTATCCTGCTACGGAATTGGCCATTCGCCGCTGCACAGGGTACTGCGAGCAACAGGATGTCCACTCGGAAGGA
GCGACGATTCGAGAGGCGCTCACCTTCAGTGCCTTCCTGCGTCAAGACAGCAGTGTATCGGAACGTGCCAAGCTAGCTTCCGTTGAGGAGTGTTTGGACC
TTCTGGACATGCGCGCCATCGCCGACCAGATCATTCGTGGTCGCTCGCAggagcagatgaagaggTTGACTatcggcgtggagctggcagcaCAACCCAG
TGTGTTGTTCCTTGATGAGCCTACCAGCGGACTGGATGCCCACTCCGCCAAGGTCatcatggacggcgtgcgcAAGGTGGCCGACAGCGGACGAACGGTT
GTGTGTACGATCCATCAGCCTTCTTCGgacgtcttcttcctgtttgacagtctgctgctgctgaagcgcggTGGTGAAATGGTGTTCTTCGGTGAACTTG
ACAACGCGCAATCGGGCGAGCGCGAGTgtggccacctcgtcgactACTTCGAGGCGATCCCGGGAGTTGCTCCTTTGCCCGAGGGTCACAACCCTGCAAC
ATGGATGTTGGAGTGCATCGGTGCGGGCGttgccggtgctggagagAAGCCGATGACGGACGCGGCTACGAACGTTGACTTTGTAAAGCACTTCCGTGAG
AGtgcagagcagcaagagTTGTTTACTGGGTTGGAGCAGCCTGGAGTCTCGACCCCTGCACCTGATCGTCTGCCAGAGTTAATTTTCAAGAACAAGCGCG
CTGCCAGTCCGTGGACACAGCTCCGTATGCTGATGGGGCGGTTCATGACAATTTACTGGCGCACCCCGTCGTACAACTTGACTCGGTTCTTGATCGCGTT
TGCACTTGCAGTGATCTTTGGACTGGTGCTCGTCAACGGTGAATACAAGACGTACCAGGGACTCAACTCTGCAGTTGGTATTATTTTCATGACGGCGCTT
TACCAAGGTTACATCACGTATGTCGGTTGCCTGCGGTTTACCTTGCGTGAACGTGCATCCTTCTACCGTGAGAGAGACGCGCAGACATACAACGCGCTCT
GGTATTTCGTTGGCGCTACGGTGGCGGAAATCCCGTACGTGTTTGGAAGTGGCCTCATCTTCACAGTGATTTTCTTCCCATTGATGGGTATCGGGTCTTT
TGGAACGGCCGTGCTGTACTGGATCAACGTGTCGCTCTTCGTGCTCATGCAGACGTATCTGGGCCAGCTTTTCATTTACGCGCTGCCAAGTGTGGAGGTG
GCAGCGATCGTCGGTGTGTTGATCAACGCCATTTTCCTTTTGTTTGCCGGCTTCAATCCACCGGCAGGCTCCATCCCGGACGGCTACAAGTGGCTGTACC
ACATCACCCCCCAGCGATATTCGTTGTCGATCCTAGTCGCACTTCTTTTCGGCAACTGCCCAGAAGACCCGACGTATGACGAAGCTTCGCAGACGTATGT
GAATTTGCGATCAGAGCTCGCTTGCCAGCCACTGCAGAACACACCGCTGTCCATCGGCCACACGACCGTCAAGGgctacatcgacgacgtgttcaaCATG
AGGTACGACGACGTGTGGACCAACTTCGGCTACGTGTTCATTTTCCTGGTTGTATTCCGCGtactgtcgctgctggcactTCGTTACATCAACCATCAGA
AGCGGTAGCGTTGTACTAGTAGTAGCAGATA