Description :
From Genome Similarity Track
Location :
Scaffold_413:1- 3326
Transcript NameFunction/comments
g16993.t1XP_009521616.1 hypothetical protein PHYSODRAFT_327246 [Phytophthora sojae
g16994.t1hypothetical protein

Sequence
3325 bases(100 bases per row)
TGAAGAAGTCGCCAGTGAAAATAACAACACCAGCGTTCGTGCACACCGATATAGCTGCGAAGGCCTGTAGCACCAGGTACCAGTATCCCATGCTGCGCAC
GTTACGCGGGCGGGGACGGCGCGACTCAAAAATGAGACGGTAGGCGTCCAGGCGGATCTCGAAGTAGTTGTTCACATAGGAAAGCAGTGGCGCAAATGGG
AAAGCCACCACAAACATGGTCGTGAAGCCGAATTGAAGCGCCATCTCGGTGTAGTCGTCGAAGGTGCCGTGCCAGTCGTACTGAGCCATAAACAGCTCGC
GCTCGGCGTCGGACTTCTTGTACTCGTCCAAGTGGCCCAGCAGACGGTACTTGCTCATGTATACGAACAGGCGCGGAATGGCCACCTCCGTGATATTGCC
CACGAATAGGCGAGAGCAGAACACAATGGCGAGCATGTACTCCAGCTCGTGCATGCAACTCACATCGCACCCTTCGAAGCCCTCCTTCAGGAACGCCACG
TAGAAGAGACCTGCGTAGTTGTTAACGAACTGGAAAATCACAGTCTTGACAATGAGACTGTTCTCGTACTCCATGTCCGTGCGATGGTTCTCCTGATCCA
CGAGCAAAACGGAAACGTAATTGTAGATCTTGGTCATGATAGTGATCTGCACAACGTTTGCAAGAGAGGACACAATCGATCCGTACTTGTAGTCGTCCAG
CACCAGCTTGTCGGAGTCGTTGCCTTTGGTCAGGTCGTATGTCAACATGAAAATCGATGACACAAGCACAAAGACGATGAGGATGAGGAAGGAGATGACG
ACCCAACTGTAGGCCACACGCTTGAGCTTCTCGCGTGGAGGGTAGAATCGTGTGGACTTGCCATTGATGGGCGAAGGGATGCGCTCACCGTAGAACTGCG
GACGAGGATTCACCGTCTCCGAAAAGTGTGCGGTGCCCCAGCGAAGCGTTTCTCGTGAGTTGAGTCGTTTCCAGTTCTCGAGATAAATGGTCATCCAGAC
GGTCATGAAGGCACCAAAGATCGGCGAGATATACGCGAACACGGTGTTGTAGTCGTCATGAGGGATGGAGTAGCTCACGACGCCCGTCACGATGCCCACC
AGTGTCGGGTACAGCAGCCATTTGGTGTAATGTCCCAGATACAAGAAGTAGAGCGCCACCTTGACGCCAAAGTACTGGCAGATGCGGTCAAAGGGCTGGT
TCATCGGGGACTTGTTCCACACGATCCATTTTTCCTTGAGGTTCATCTTCTCCTCCTCTTCGTGCAACGGGTAGGTCTCGACGATGATTTCTTCGTAGAT
CAGTCGGTCGATGTCCTGACCAGCTCCTGTCTGGTGGTTGGTGATAATGTGCTCGATGAGGCTGATTCGGTCGGTGCTCGAAAACAGCGAGCCCTTCTTG
GTGTAAAAGGGCTGCAAGTCTCGGGCCTGGAAGTACGGCGCGAAGATGTAGTCAAACGGCGAGTACCTGTACGTCTGCTTCACGTCCCGGATCGGGAACG
GCGCAATGCCGTACTCGGGGATGCCGTTGAACGAGGCCCGGCGCAGCTCGGCCGGGTCCAGCTGAAGGTGCATCTTGAGGTACTCGGCCTCGCGCCGCAT
GAGCTCCTCAGGCGCGCGGATCTTGCAGAACACGAGTTCCTTGCCGACGGAGTAGAAGAGGCGGAGGCGCAGGCCGGCGCCGCGCAGGCGGTTGATGATG
GTGTCGCGCTCGTCGCTCACCTCGATCACATGCTTGGGCGGGTTGGGAAACACGATCACGTAGTCCCAGCGGCCTGACGTCTCCGTCGTGGACGTGCCGT
AGTCCAGCGGCACGCGCAGACGCACCTCGGCGGTCTGCGGCTGCGGGTATGGGTCCGTCATTTGAAATTGGGCCAGCCTCGTGTGGTGTGGCGTAAATCG
TTTTAAATAATTTAATTCCTGATTTTTTTTTCGGGGGGGATTCCCAATCTCCTACAAGTAACGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACG
CGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACATACGGGAACCACGTGA
GACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAA
GCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACG
CGGGTGAAAACCCAGGACCAAGCAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCTACTGTAAAA
TATACTGATATAAAACATAAGCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCC
GCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGGGTAACGCAAATCCGGA
CTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTATATAGTGGAGAC
TCTGCGCGATTGGCTGTTATAATGCGTAGTGTGGACTACACCACATCGGAAGTAGCCGAATAAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTT
AACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGGGAGATTCCAGGCAAATTCTGCAGGTGGTGAAGGGCGGATCGGCTACAGAGACAATCGA
CGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCGATAGTGCTGCA
GAAATGGCTGCGTTTTCCGAGTACCTGTTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATCAAGATTCCACGTGACA
TGCTCATCGACAACCCGTCGGTGATCCAGATGATGACGAGAAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCC
GACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAG
CGGATCGCATGACGGGACCAGCTCG