Description :
From Genome Similarity Track
Location :
Scaffold_224:1- 3292
Transcript NameFunction/comments
g13562.t1hypothetical protein
g13563.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
3291 bases(100 bases per row)
AGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGC
TGGTACGGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAA
AGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGAAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCA
AGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTC
GGGGCATCGTGGTACTCATACGTGATCTTGAGCTTCAACTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGTGCTGTAAAGCAGCA
GACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGATGTTTAGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTG
CTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACGTCATCCAACAAGGACGACGAGGGAATAGTTGGCCTCTTGCACCGCATAATCTGGTCGACGCGA
AAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTAAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTTATATG
TGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCAAAACTTTGCGAGTGCATACT
TCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCATCTGACGCGATTGATAGTAAACCACACGATCACGACCTTCGTGATC
GAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGACACCGCCAAGATCGGCGTCTCAGTC
AAGCCCTGCTTGACCGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCG
CGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGAC
CTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGC
TTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGT
CGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAG
CCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTA
CTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCAT
GAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTC
AAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACA
CCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGC
CTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTC
GACGTCCGAGAGGATGCAGATCTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGG
ATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCA
GACACTGCTTGTAGCGTCTCGGTCCCTGACCGATACTTGCGCAGCTTTTCTCGCTTGTGCCGTTCACTTCTCGTACGGAGCCCGGCTCCGCGAGTTTCTT
CTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTATCCGCGGGCGCACGCGTTCAAGCCCAGCTTGATCGCGCACCGCTTC
GTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGATTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCG
TCTTCTTTACCTCGACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACC
CTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGC
CGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCG
AAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGA
CGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTC
CAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACT