Description :
From Genome Similarity Track
Location :
scaffold_1549:1- 3266
Transcript NameFunction/comments
g11519.t1 putative polyprotein
g11520.t1 putative polyprotein

Sequence
3264 bases(100 bases per row)
GGGCCGCCGTTGACATGAGGAGGCGCGTACCAAGCAGCTCGAAGAGGCGGTCCCAGAACGCGGAAGTAAAGCGGGGATCACGGTCGGACACGATAGATTC
CGGCAGGCCATGGTGCCGGAATACAAGTTCGAGGAACAGACTGGCCGTCTCCTCAGCGGTAACTTGGGCGGCGACAGCAGCAAAGTGGACCATTTTGCTG
AAGCGATCGACGAGCACCAGGGCACTAGTGCGGCCCTGGCTGTCTGGCGGTAGACCGAAGACGAAGTCCATGCTGACAGATCACCACGCTTCTGCAGGAA
TGGGAAGCGGCCACAAAGGAGCTTGCGACGATGGAGAGGGCTTCACGCGCTGACAGGTCTCGCAAGAACGGATCCACTTCCGTATCCACTTGTACATCTG
AGGCCAGTAAAAATCTCGGGAGAGCGCGGCGAATGTCTTCTCGCGACCGAGATGTCCGCCAACAGGAGAGTCATGGTACTCATGAATCAGGCGCGCTCGA
AGGTCGTCATCGGCAGGAATGACGGAATGACGACGCGAAAGTGTCCATCGTATACGTCAGCAGAGATCCATCAAGCTGGTAGCGCGCGATGTGGTCGCGT
GTCGGACGCGTCAACTTCTTCAACGACTCGGCGCAGGGTTTCCGGAGGTACGCAATGATGTCGGCGTAGAAGGAGTCAGCGTCGTATGCTTCAGCAATCA
GCTGACGTAGTGGTGACACTGGACTCGATACCGTCGCGTTCAAACCCAACGCGACGCAGCAAGCACATTCATCTTCGTCTTCGTCATCAGGTATCTGAGG
ACCAACGTCGCGGCGTGGGTCGTAGTCCGGACGGCGTGATAGCGCGTCGGCAAGAATGTTATTCTTGCCGGGTTTGTAATGGACTACGAAGTTATACTCG
ACAAAGAAGGACAACCACCGCGCCATCCGCTGGGACAGATGTGGGCTCTTCATCGCGGTTCGCAGGGAGGCGTGGTCCGTATAGACCGCGAACGTCTGCT
CTCCGAGGAGGTACACTCTGGATTTAATCAGAGCGTAGCGCATCGTGAGGAGCTCCTTGTCATGGACGGGATAATTCTTCTCAGTGGGCTTCATCTGTCG
TGACTGGTAGCTCACGACACGCTCGCAGCCCTCATCATCAACTGCATGAGGGCGCAGCTGATGGCGAAGTCGCTCGCGTCGCACACGACATGAAACGGTT
TCGTGCCATCCGGCAACATCAAGACAGGAGCCTCAGCCAAGCTCTTCTTCACAGCGTCGAACGCGGCTTGATGTTCGGGGCGCCACAACCACGTGATATC
CTTCTTGAGCAGCGACGACAGCAGGTGGATCAAGCCTGCGTAATCCTTCGTATACTTATGGAGGTAGTTCGCAAGGCCCAACCATTGCCGCAGCTCCGTC
GGGTTCTTGGGTGTTGGCCAAGAACAGATCGAGGAGATCTTTTCAGGGTCCGCCCGGACACCATCCTTGCTCACGTAACAACCAAGGACCGGGATTTCGG
GAGCACAGAAGACGCACTTCTTCAGATTCGCGTACAGCTTGTTCTCGCGCATCACTTAGAAGACCTGCCTCAAGTGCCGCAGATGTACGTTGACAGCGCT
GAGACCCTCCTCAGCGCGGCTGTGGACGAAGATGTCGTCGAAGTAGCTCGGCGCGAAGTCGCGGAGTGGACGCAGTACGTGAGGCACCATTCGATTGAAA
GTGGCGGGAGCGTTCTTTAGACCCTATGGCATTACGAGCCACTCCCAAAGCATGCCGCTTGGGGTGCTGACGGCCGTGAGAGGTATATCGCCCTCTCGCA
TGAGGATCTGATAGAAGCCATCCGTCAGGTCGATCGCGCTGTAGATCACGCTGCCCGACATGGAGTCCAGTACCATGTCCTTCCGAGGGATCGGCGTCTG
CGCTGGGATGGTCGCGTCGTTCAGCTTGTTGAAAGCGTGGACAATAAGCCAACCACCCGTGGCTTTCTTCACGCAGAAGGTTGGACTCGAATGTGGCGAA
ATACTCTCGCGCACATGACCCGCTTTGCGCCGACTTTCGAAGAACTCATCGATAGCCTTGACTTGGTCCCGCGACAGTGGTCACTGATGTGTCACGCAGT
ACTTCGTACCAGGCATGAGATCGATCTCATGTCGTACGCCGCGATCAGCTGGCAGTTCAGCGGGAATCTTCTCCGGGAAGACGTTCGCGTACTCGCGGAC
GGTGTCGTAGGCTGGGTTACCCGAGTTGCGAAGAGCTTCCCACGACTGGGCGACGAAGCGTTCTTCGCGGACTGTCTTCGGCTCGGCCCCCACAGGTCGA
GTCGGCACGTCTTCCTTGCTGACTGCGTTGAGGTCGTGCGTCGAGTTGGCCTCAGTGATCAAGCACACTTGCTCGATGTCGCCGGCCTTCAAGTCGCGCA
GGAAATTCTTCCAAGACAAGCCTGGGAGTCTCGATATCGTAGCTGCGTCGCCAGGGGCACTCGCGACTTCGATGGTCCTACGACGCTGTGGCGAGCCTTC
GATGTATTCCAGCGCACAGATGGATTCCATCGCAGGGGCTGCGTCTTCCCTTGGGCGTCGCGGCTTAAGGCGACGGCGCTTCGACTTCTTCTTTCGCCTC
GAGCCTCTGCTCGAAGCCGAAGAGGCGCTGACGGTGGAGAGCGTGTCACCCTCCTCTAGGCGCGGGATCCCGTTCTCAACCGCGCCGGTCTCATGCCGGA
GTCGCCTTCGCTCGACCGCCTCGTTATGCTCACGACGGCGTGAGTATTCCCCGCCGCCGAATTCCTCCACTTCCAGGGAGACCGCACAGGCTGAACATAG
AGGGCCATCGCTCTCTCTACATAAGGCGTGTGTCGTGGCGGCACCATCCACGACCCGGACGTGCGGCCAGTCGGACGGCGCAACCAGAAGGTGAGTGAAA
ACCTCGCTCACGTCAAACCCACTCCGGTGTTTGACAGATCGAGCGAGCCAGTCGATCTCCGGCTGGTACCGGGAGAGCCACGGGATCCCAAGGATACAGT
CGAAGGCGTAGTTCATCTCAAGCACGAGGAAGTCGTCATTACTCTTGAAGCCATCAAACGTATAAGGCAGCGTGATATCGCGCCGCGAGACGCGGTGTGG
CTTACCATCGGCTAGCTTGACAATGATCTCGCCAGGACTGTCACGGACGGGAATCGTATCAGGGAGCAGCGAAAGACAGGAAGCACGGAAGAAGTTGTTC
GATGCTCCAGAATCGAGCAACGCGCGGAGGGGACGCCGCGCGCCTTCGACGTGCAGACTGACAA