Description :
From Genome Similarity Track
Location :
Scaffold_1217:1- 3252
Sequence
3251 bases(100 bases per row)
GGACTACTGTCGCCCCTTCCACAGATACGGACGATCACAGACGCAATATTACCGCGCTAGTGACCCTCTTTCGGGAAGCAGGCATGGTCGCAGAAAGGTT
CCAACCGAACGACGTGTTTGCCCTGGGGTTCGACAGCATCACAACGACGTTAGAGGAACTACCCAAGCGTGTGGGGATTCTTTTCGGGATACGCCTTACA
GGACACACCTTTTATCAAGCCGCATACGTGTATGAACCTAAGAAAAACAGTCATATGACTCTTCAGGATACCGAGGTTCATCCTCCAACACAAGCAGTGA
CCTGGGACCCACCATCGACTGACCCACCATCTCGCGAAACCCAGTCTTCACGTGCCCAGGCCTCAGCAGGGTACTCGTCACAAGGATCCTCAACGCCCAG
CCACTTCGCCCGAGTGTCACTGGGACCTACCGGCACCGCGTTACTTCAGGCCCGCGCGCGATATGCGCCGGCGGAACAGCCCACTTACGACGGGGCGACG
CGTGAACACCCAACGGAAATGCGGACCCCTGATAGGCCACAATCTCGCCCAATAACAAACCGACCAAATCATCCCAAAATCTTAGCGCCGCCACGTGGCG
AAGGTGCTGAGGGATAGCGCCTACCTACCCGGTAGGTAATCTGCAGGCATACTTCGATGCGGCGATGGAAAGGTTCTTACAAGAACGCCAAGCGCCATCA
ACACGCCCTAACCGAGAAGAGGCTGGCGACAGGGAGCACGACCGGCGACTACTGGAAATGGTCCAAGGGAAGAGGTCCAAGCCCAAAGACAACCCCAAAA
TGTCAGACGTCGACATAGAATCGGTCGGCTCGTGCGAATGCGGCCCGGATGATCTGGACCTGGAGGAAACTCCGGCGAGGATGGCCAATGCCACGATGGG
ATAGCTACTCAACATGGGTCCCTCGCATCACGCTCTCTGCAACTTTTGGGACCTCAAAGAGTTTAATGGTCGAGACCTAGACGAGGACCGAGCTCGCAGT
TGGGTAACCACAGTGAAGACGGCCTTCGCAAGTGACCAAGCACCGGACAGCAAAAAGTGTCTGGTCTTCGAATGACTGGTGATTGGGCCGGGCAAAGAAC
TGGTACCACCAATTGAGCCGCTCCGTTCAAGAAAATTGGAAAGACCTGCTACGAGAATTTCAGATGCAGTTTTATAGTCTGGGGGTACCAGTTGCTCGCC
AGTACTACCACGCGAAGAAGAGGTCAGAAGAATCCACGTTGGACTACCTATACCGCCTGAACGTGATTGCTCTCAGGGAGAAGCTGAAGATCAAGAATGG
ATCACCCAAGATCCATAAGGAACACGTCGAGCATTACATCGAGACTGTAGACGGCCCATAGTTGGCAGACCAATTGACGATGCTACGCCTAGCAGACGTT
GAAGGATTGGAGGAAGTATTGAAGGCACGCCAGAAGACGAAGGCACGACGCGGCAAGACGCTGTTTGGTATCAGAAAGTTCCGGCAGTAAGTACCTGCAC
CTCCGGATCGACCTAGAGATTTAAACCGCCGTTCTATGCATGCAGTCCGAGCGACACTAGAAAAGTCGAGTTCGGAGGATCCAGCCTGGATTTCGGATAA
CGAGGGAGACCTGAGACGGATCGACTTAGCGGAAGCGGAAAGGGACCCAAGTCCAAGAACCGCGAGGAACCGGCCCCCAAGAGAGGTCGACTAACATCGG
AAACAAGCAGAAGGCCCCAGAACCTGCAATACGTCGGCCGAGTCAAACGTACGATGCACCCAATACGGGTCCAGGAGACATGGAGACTTGAGATGCTGGA
AGAGAATGACCTGTGACCACTGCGGAAAGAAGTGACATCCATCGGATCGCTGCTTGTTCGTGTGTCGGGGGTGCGGAGAGACTCATGAAGCGAGGAAGTG
CCAGCTGAAGGACTTCTACAACTTGATTCGTCAATGGTACAACCCCACCAAGCACGCCGGAATGTTGCCCGAGAAAGCGGAGAAGATGATAAATTAGAAC
GCTCGCCAGGTTTGAATCCGTTACGAGTCGAGCGTCCTAGTTTTTGTATCTTTGCATATGTGGAAAAGCAGCCCGAGAGGGATAGGGGGATTTTCTATTG
AAAAGACCGATAATATATCGAAGATTGGAAAATATCACATGGTCCATGTTGTTTCTCTCAATGAACCTAATGATTTCGCCCGGGAAAATGCAGTGATGGA
ATTAGACCTATTGCCTGGAGAATACCGAGGATACTGGAAATAACACGCCCCAACTAAGTGGTTTAAACAAGCCAAAGCCTCTGGAAAGATTAACAACGAT
CGCGCAAATTTGTTGTTCGATACTGGCGCCGAAATATCCATTTAAAATATCGCCTTTGCTCATAAGGTAGGCTGCCAAATTGACGAAAGCGAACGACAAG
AGTGCATTGGCATTGGGGAATCGGTGTACTCTACGGAAGGGCGCACTTGCATCAAGGTCACCCTAAATGGAAATCTAGTGTATGTGTCCAATGTGTGGCT
AGGCCATATGGTAGGTCAGGATGCAATATTAGAATTGGATTTCATGGTCCCGGCTGGTATCCGGCTAGATCTGGTGGATGGAACACTCTGTCTCCCCTAA
CGAATTCCGGATACAACTTTCCGGACGAAGGACCGTTTACGGTAACCGAGTCGCAGAAGTGAAGTTGGGACAATATGCCCGTATACTTGCCCATGGATGT
CTGGAGGTACCCCTTAAAAGGTCGATCTCAGATCTATGGAGGATATGGGTCACAAGAGGAGAGTGATGGGTTAAGACTATGGCTTGGGGAATAGGACGTT
GACAATTGCTGAAGGTGACCAACTTTAGCCCCCACATGTTGAAATTTCATGATGATACCAAGATAGGTAATTGGCAGAAGAAGGATCAAGTACCAAGAGC
GCAATGTTTCGTCTTGGTAGGCTCTCAAAGGTACGCTGAATGGCTGAACCTGGCCTACGAAGCCACGACCGACCAGGTCGACCCCCAGTTGACCTCGAGG
AGAAAGACGAGACACCAATGTGGAGACTCCGTAGTACAAGATCCCGTCGCGTATTTTGCAGCGGTCGAAGACCCCAGTCTCAATTATGAACCTGTCACAC
CAGCGGCTACCAGAGTGAGAAGAACAGTCACGCGAAGAAGAGACCTCTCAAATACGAAGTGACCCCAAAGACGATCCACCGGGAGCAATCGCAGTCGAAG
AAGAGAAAGCCGAGACCAACGAATCGCCACGAGACGACGAACAAGTGTGTA