Description :
From Genome Similarity Track
Location :
Scaffold_1983:1- 3092
Sequence
3091 bases(100 bases per row)
CTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTATGCACTGTTTGCTGCGGTACTCTAGGAATTGAGAGAGGTGGATTTTGCTGCGATGACC
ACTTCAGCTGTCCGGATCAAAATCCAACAAGCTTTGGCCCTGGAGATATCGGATCCACGAAGGGATCGAAGTAGTACGACGCCAGAAGAGGACCAACGGA
AAGAGGATCCAATCTGGATGGAGACGACGGATCAGAGCTCGGAAAAGGTGGAACCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTAAGGAACAG
GATCGCGACTACGCCCATCCTCCGCCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTTGGCAGTCTCAGCGGCCTTCGTACAA
GAACATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACGCTAAAGCCAAATGAACTGAATTACGGAGCGGTGGAGAAGGAGATACTCGCGCTCC
TGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGGCACTCTACACTAGCCTGGCTGTTCAAGTCGGCCGGGTT
GCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGACTTGGCC
GCGAGCATCACACCTCGAGCCAAGATGGACGAAGCGCTGACTAGGATCGCTCCTAATAAAGAGCCCAAACGTCGAATCCAGATCCCGATCCCGACGGTAC
AAGTGGATGAGGATCTGTACGTCCTGAGCTTCGATGGATCTGCTCGCGTGCGACGCGGTGGAGGAGCATACAGCGCCATACTGTGGATTTGCCCGGATGG
GAAGTGGTAAGGGCCAGAGCCTCCTATGCGGAAGGTCTCACCGTCAATGAAGCGGAGTATAACAACGCCTGCTGGGTTTGGATTTACTAAAGGAACCGGA
TCCGAAAAGGCTGGTGATATATGGAGATTCAAACTTGGTGATCCGACAGGTGTGAGGTTAGATTGACTGCAAGCCCCCGGCCCTAACGCTGTTACGGCAG
AAGGTGATGGTCCACCTGCGTGATTGGATGAATCACGAGTTAGTACATGTCAAGCGAGATTGGAATGCCAGTGTGGACAGCTTGGCCAGTGCCGCTTTAC
GGAATCAATGTGGTGTCGAAGTGAAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGTGAAGCG
GACAGTCCAGGTATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCTAGCCCCCAGATCCTCGATGAAGCATTTGTGAAGGGGGTCCGCATTGAGCGGA
TCCTCAAAGCACAGAACGAAGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGCAGATATACGAGACTTGAGCCGGATGGATGCCAAATCCTACAG
CATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGAAGATCGGGATGGATTAATGAGATTG
GTGATGCCAGAAACCTTACAACAGGATGTCCTACACCACTACCACGCTAGTTTAGAAGGTGGACATCAGGGGATTGGTCGGACCTACCAACGGATCCGGG
AATGTTTCCACTGGAGGGGACTATTCAAGAGCGTGCAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGA
GTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATTATAGCCATGGATCACATCCCCTCGTTACCCAAGTCGTTCAAAGGAAACACAGAGTTGTTG
AGCTGGATAGATCTGTTTACCGGATATGTGATAGCCAAAGCTAGCGCGTCTAGAACTGCACAAACCATCGCCGAATCGTACGAGGAGTGCGTTTTCCGAA
GATTTGGAGCTAGTGAGATGATTCGGCATGATCGGGAGTCAGGATTTATGTCTGATTTCTTTCGAGCCTTCAACCGGATCCTGGGGCAGAGACAGCGGGC
GACTATGGCATATCGTCCCCAAGCAAATGAATCGGCCGAACGCATGGTACAGACGATCACGAGAGCGCTCAAGATGTATGTTCAGGATTTGGATCAGAGG
GATTGGAATGAGTACGCAGAACGACTCCCCTTCGCGATGAACATCGCCCAAGACAGGATCCAGTGTGACACCCTATTTTACTTGGTACATGGGTGGAATC
CTAAATCCATCCTAGAAGCAGCTATTCCGGTAGGTAGTACCAAGAATAGGAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCA
AGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCAAGCGGATCGACACAACGAAGACGTCGTCCACATCAAATCCAAGTGGGATCGC
AAGTGTGGCTTTATTTAGATCGGGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAGATAGGGGAACG
TGCGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACCCGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGACCGGCCGCAA
ACCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAG
TAGAGAAGATCACCGACATGAGGTCAGGGAAGCGAACTAGATACGGACGGATTTACCGTAAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTG
GGTAGACGAGGCAGCTCTGAACTGTGGAGCATTACTCTATGATTACTTGCGGGATCGTACGAATCGGAACAGATTCCGCGTGATGCAGTCTCATGAAGAA
GAGTAGGAAGGGGATCCATGGATGTGAGTTGGTCATGTCGATAGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGTCGGGAGGAGGAG