Description :
From Genome Similarity Track
Location :
Scaffold_2125:1- 3063
Transcript NameFunction/comments
Phyta_totarag14133hypothetical protein

Sequence
3062 bases(100 bases per row)
GAAGCCTGGCTCTCGATCGTGCCGGATTGCTTCGCTTGCACCGAATCGTCGGAAGACGCACTCTTCGTAATTTTCCGCGATCGTTTGAACTGTTATCGAT
GCACTTGCTTTGGCGATCACGAAGCCGGTGAAGAGATCGACCCAGATCAACAATTCCGTGTTGCCCTTATAAGATCGGGGCAGCGCCGGGATGTGGTCCA
TAACGATGATCTGAAATGGGTACGTCGCTTGTAGGTTGCCCTGCGATTCACCTCGAACAGTTGGTCTCTCTTTCCCAGTCTCGCAGTCTATGCACTGACC
CACGTAACGTTGTACATCTTAATACGGTCCTCTCCAGTTGAAATGTGCCTTGATCCGCTGGTATGTCCTCCCGATTCCTTGATGTCCACCTTTCAGACTG
CCATGGTAATGATGTAGGAagtcttcttgcagcgtctCAGGGATCACCAGTCGAGCAACGAGATCGCGATCTTCATTCGATTGCTTGGACGGCGGGCAGT
AAAACAACAAGCCCGTCTCGTCGACCTCATAATCTTCAGCGATCTTAGGGCAGGTCTTCGCCTCTAATGAGGTAAGTTCCTGTACGTCCCCTCGCAAGTA
CTGCTTGAGATCGACGATCcacttttcttcgtcttgtgcCATGCATATTCGCTCTTCCCTCATTTTCTGAACAATCTCCTCCTGTAACACTTCTGGGCTG
CGCCGCTTGCGCGACCTCGTCACGGCCGTGATTTTGGTCACTGTACTGTCAGGTCGTGGGATCAGTATCTCGTCAAGACGGTTAAGCGTCATCACGTCTT
GGAACGCTTCCTCTGACGTCACTACCGTGCCTCCTTCACGCTGAAGAGCGGCACCGGCGAGTCGATCTGCACTTTAGTTCCAGTCTCGCTTCATATGAAG
GAAATCGTGACTTGGCCACGATCTCAAGCGTTCCATAGCTTGTTGGCGTAGTAATTTTAACCCAGATTCATTGCACTCGTTCTCGCCTCGCATCTGTCGG
ATGACCAAATTCGAATCTACGCAGATAATTAGCCGTCCCCTGTCCAGGTCGGCCAGAAGATCGAAGCATAGGAGCAAACCATGATATTCCGCCTCGTTGA
CTGTTAAATCGTCCTTGTACTGCGACGCAACTGAAATCATTTTCCATTCGGGTAAGCTCCACACAATGGCACCATACGCTCATCCACCTCGCTTTACTCG
AGCTGATCCATCGAAGCTGACCACTAGCAACTTTTCATCCGCCTCCACCGTAAGTGGCGGCATGGTAATTACCTGCCGGGACTGCTTCCTGGGTGCTATC
GAAACTAAGATCACGTCGATCTCTTCACGTGGCGTGATGCTTGCAGCCATTACGCCCAGGATCTCGTCCTCACCTTTGTCGCacttgacgatctccaggG
TCCAGCTCGACAGCAACGCGGCCCAGCGACCGAGTCGTCCTTGCAATCCTCATGAGTGCACTAGCCATGCCAATGTGGAGTGCCGAGTCGGCACCTTGAC
CGATCTCGTCACTAGCTGCGTGTAGCAGACATCCCAAATacggagcagcgcgagaactTCCTTATCGACGATTCCGTAGTTGATCTCGTTAGGCTTGAGT
GTCCGGCTAGTAATCGTCATCGGTTTATATACGCCCCCATGTTCTTGCATCAACGCGGCCGCAATTGCCCACTTGCTCGCATataccaccaccaccggtC
TTCGATCCGgatcgaagtgctgcaagatTGGTGTTGTAGCGATCTNGGTAGTCAACTTTGCGTAGACCCCAGAAACTCTTGGCAACACTGATCGATAGGT
TCCACTCATCACAGGCGTCtagcatcttctccacctttTCGCACAACGTATTCCACCAATCTGCCGTCACAAGGATGTCGTCAATATAAGTTCGACGACC
TAGCACCGACGATTCCTTTCCTGCGCCAGGCACTCCCTCCTCGAATACGTCAGTCTGGTTGGCGTGATCTTGGCCGCTTGTAATCTTGAGGAACCCATAC
AACGCGTTGTCTACCGACCTCTGGTAGATCTGCGGCGCGTTCTTCGATCCAAACGGCATTCGATTCCACTCGAATAACCCGAACGGGGTAATAAACGCCG
AGATCGCGCGCGCTCGATCAGTCATAGAGACCATCCAAAATCCACTAGCCATGTCCAGTGAGCAATATCAGAGGATCTTGGCAAGATCGTCGAGTAGATC
ATTGATAAGAGGCATAGGGTACACCATTAGTCGGATCAGGCTGTTGACCAGGCGAGAGTCGATACAGAGTCTAATGTCGACCCcattcttcttgatgatc
acGACGATCGGGGACGCGcatggcgacgtcgagtgTCGGATGATCTCGGCTGACAGCAAACCCTAGATCAGCAGGAACAACTTCTCGCGGAATTGCGGAG
CAACCTTGCGGTCCCGTTGGGCTATTGGTCTTGCATTTATCACATCACTGTCACAGATCGCTCCCTTCACAGCAGGTGGCAAGGCGTTCCCCTTCCCAAT
TAGAAGGTGTCAGTGACGCCAGATGATCTTCACTAGTCGATCGATCTCTTCCGGCATACTGTCCTCAGGGTTTCCCACCTGGATATCCTCGACCTTGACT
TCTtccgtcgtcgacgtgaTCTCCGGCAATACCGCCATGTGACCCTCGAGATCTTCTGCGTAGAGCTCACCTTCTTTAATGCACACCTATTCGTCTTCCG
CAGGTACTCCCGCGTAATCACCAGCGAGATCTTGTTTATTCTCGTCCGGGTCCTGTCTCATTGTCTCAGGTTTTTCTCCAATCCCTGCAGATCGATCTTG
AATGCGTTTCTNGCCACTGCCGAGCACTGCCACTTTTGGCGGTCGCTCCGGCAGCCGGGGCAAGATCGTAGTCGGAGTCTTGTACTGTGGCCGATCCACG
GTGGGCTCCTGTGGTTCCTCAAGTTCCTGGCGATCTTCGCCGATATCTACCGTCGCCTGGTAGGCCAGGTCCTGCCATTCGGCATACCTGCGCGATCCCA
CCGAGACATATCCAGGTAAGCGGGGTACCCGATCTCCGACCAGTCACATTCCGACGCGGACA