Description :
From Genome Similarity Track
Location :
Scaffold_2364:1- 3040
Sequence
3038 bases(100 bases per row)
CGGTGGCATGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTGCGGGCCAAGTTGAA
GATCAAGGATGGGGGATCCAAGGTACTACGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGAATCTGGCCGACAGGCCGACCCTGTTACGT
CTTCCAGACGCAGATGAGCTCGAAGAAGTGCTGCGGCCTGTGGATCGCGCGAAACACCGCCGGAAGAAGGCGGCGTTCGGATCCGGCAATTATCGACAAA
AAGTTCCGACACCCACGGTCCCAGCTCAACGCGTCCACCAAGTCACGGCGCCCGACGCAGAAACTGAATCGGGATCCGACGGTTAGGACTCCGACCCAGA
GGATTACTGCCGAGTCTGTCTCACTGCGCCCAACGATCGTACGGCGAAGACTGGAGACAGCTCTCGATCGGGGGATACCGTACCCGGCGACCGTGGGATG
TACAGATCCCGAGATCTCATGGACGGGACAGCGCAAATCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACCGAATCTGGATGCTGGAAACAACGGGTCT
GTGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCAACGTGTGTCGCGGTTGTGGCGAAATCCACGACGCCGGCAAGTGCCCGATGGAAGA
ATTCTACAACCAGATCCGCCAATGGTTTGATCGAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGCCGCTCGCCGGGTT
TGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAA
TACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAA
AGGGGAAAGGTATGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGG
TCACTGGATCCCGTGGATTTGAGGATGTTGGATCCATGGATCCGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGCTCAG
ACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAATCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAG
GTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGG
CAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGTATGGATTTCATGGTACCGGCCGGAGTGAGGTT
GGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGACGTCCGTTGTATGGGGCGAAGATGAGAATCATAAGGGCA
GATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAACTGCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGGCAAGAAA
TGGGTGCCGACCGTAATCCAGGGACCAGGTCGATCACGATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCG
GACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGAC
TACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAG
AGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTGGACACGACGGGGGACGAACCCCAGAGTCGGCCCTTAGATAACGCAGGGTTGGTGGATGAAGGA
TTGCAGAGGGCTAAAGCCGAACAGCCGAATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAA
CACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTTCCTGATACCAGGGTACCTGAACCCCCGAAGAT
AGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGAT
CTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAGGTCACGATTGATGATATCCAAGTGGATCCGGGGG
CGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGG
AGTCAAATGTGACATCGATGTCGGCGACGCGAAATCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGATCTGATTAAG
GGCCTGCTGAAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCA
TTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGTCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACGG
CTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGAGAA
CCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCT