Description :
From Genome Similarity Track
Location :
scaffold_1613:1- 2994
Transcript NameFunction/comments
g11573.t1hypothetical protein

Sequence
2992 bases(100 bases per row)
CGCCTTCGACTGTATCCTTGGGATCCCGTGGCTCTCCCGGTACCAGCCGGAGATCGACTGGCTCGCTCGATCTGTCAAACACCGGAGTGGGTTTGACGTG
AGCGAGGTTTTCACTCACCTTCTGGTCGCGCCGTCCGACTGGCCGCACGCCCGGGTCATGGATGGTGCCACCACGACACACGCCTTATGTAGAGAGAGCG
ATGGCCCTCTATGTTCAGCCTGTGCGGTCTCCCTGGAAGTGGAGGAATTCGGCGGCGGGGAATGCTCAGGTCGTCGTGAGCATAACGAGGCAGTCGAGCG
AAGGCGACTCCCGCATGAGACCGGCGCGGTTGAGAACGAGATCACGCGCCTAGAGGAGGGTGACACGCTCTCCACCGTCAGCGCCTCTTCGGCTTCGAGC
AGAGGCTCGAGGCGAAAGAAGAAGTCGAAGCGCCGTCGCCTTAAGTCGCGACGCCCAAGGGAAGACGCAGCCTCTGCGATGGAATCCATCTGTGCGCTGG
AATACATCGAAGGCTCGCTACAGCGTCGTATGACCATCGAAGTCGCAAGTCCCCCTCGCGACGCAGCTACGATAACGAGACTCCCAGGCTTGGCTTGGAA
GAATTTCCTGCGCGACTTGAAGGCCGGCGACATCGAGCAAGTGTGCTTGATCATTGAGGCCAACTCGACGCACGACCTCAACGCAGTCAGCAAGGAAGAC
GTGCCGACTCGACCTGTGGGGGCCGAGCCGAAGACAGCCCGCGAAGAACGCTTCGTCGCCCAGTCCTGGGAAGCTCTCTGCAACTCGGGTAACCCAGCCT
ACGACACCGTCCGCGAGTACGCGGACGTCTTCCCGGAGAAGATTCCCGCTGAACTGCCAGCCGATCGCGGCGTACGACATGAGATCGATCTCACGCCTGG
TACGAAGTACTGCGTGACACATCAGTGGCCACTGTCGCGGGACCAAGTTAAGGCTATCGATGAGTTCTTCGAAAGTCGGCGCAAAGCGGGTCATGTGCGC
GAGAGTATTTCGCCACATTCGAGTCCAACCTTCTGCGTGAAGAAAGCCACGGGTGGCTGGCTTATTGTCCACGCTTTCAACAAGCTGAACGACGCGACCA
TCCCAGCGCAGACGCCGATCCCTCGGAAGGACATGGTACTGGACTTCATGTCGGGCAGCGTGATCTACAGCGCGATCAACCTGACGGATGGCTTCTATCA
GATCCTCATGCGAGAGGGCGATACACCTCTCACGGCCGTCAGCACCCCCAAGCGGCATGCTTTGGGAGTGGCTCGTAATGCCACAGGGTCTAAAGAACGC
TCCCGCCACTTTCAATCGAATGGTGCCTCACGTATTGCGTCCACTCCGCGACTTCGCGCCGAGCTACTTCGACGACATCTTCGTCCACAGCCGCGCTGAG
GAGGGTCTCAGCGCTGTCGACGTACATCTGCGGCACTTGAGGCAGGTCTTCTAAGTGATGCGCGAGAACAAGCTGTACGCGAATCTGAAGAAGTGCGTCT
TCTGTGCTCCCGAAATCCTGGTCCTTGGTTGTTACGTGAGCAAGGACGGTGTCCGGGCGGACCCTGAAAAGATCTCCTCGATCTGTTCTTGGCCAACACC
CAAGAACCCGACGGAGCTGCGGCAATGGTTGGGCCTTGCGAACTACCTCCATAAGTATACGCAGGCTTGATCCACCTGCTGTCGTCGCTGCTCAAGAAGG
ATATCACGTGGTTGTGGCGCCCCGAACATCAAGCCGCGTTCGACGCTGTGAAGAAGAGCTTGGCTAAGGCTCCTGTCTTGATGTTGCCGGATGGCACGAA
ACCGTTTCATGTCGTGTGCGACGCGAGCGACTTCGCCATCAGCTGCGCCCTCATGCAGTTGATGATGAGGGCTGCGAGCGTGTCGTGAGCTACCAGTCAC
GACAGATGAAGCCCACTGAGAAGAATTATCCCGTCCATGACAAGGAGCTCCTCGCGATGCGCTACGCTCTGATTAAATCCAGAGTGTACCTCCTCGGAGA
GCAGACGTTTGCGGTCTATACGGACCACGCCTCCCTGCGAACCGCGATGAAGAGCCCACATCTGTCCCAGCGGATGGCGCGGTGGTTGTCCTTCTTTGCC
GAGTATAACTTCGTAGTCCATTACAAACCCGGCAAGAATGTTATTCTTGCCGACGCGCTACCACGCCGTCCGGACTACGACCCACGCCGCGACGTTGGTC
CTCAGATACCTGATGACGAAGACGTAGATGAATGTGCTTGCTGCGTCGCGTTGGGTTTGAACGCGACGGTATCGAGTCCAGTGTCACCACTACGTCAGCT
GATTGCTGAAGCATACGACGCTGACTCCTTCGATGCCGACATCATTGCGCACCTCCGGAAACCCTGCGCCGAGTCGTTATAGAAGTTGACGCGTCCGACA
CGCGACCACATCGCGCGCTACCAGCTTGATGGATCTCTGCTGACGTATGCTATGGACACTTTCGACGCTCCGCGAGTGGTCATTCCTACCGATGACGACC
TTCGAGCGCGCCTGGTTCATGAGTACCATGACTCTCTTGTTGGCGGACATCTCGGTCGCGAGAAGACATTCGCCGCGCTCTCCCGAAAATTTTTACTGGC
CTCGGATATACAAGTGGATACGGAAGTGGATCCGTTCTTGCGAGACCTGTCAGCGCGTGAAGCCCTCTCCATCGTCGCAAGCTCCTTTGCGGCCGCTTCC
CATTCCTGCAGAAGCGTGGCGATCTGTCAGCATGGACTTCGTCTTCGGTCTACCGCCAGACAGCTGGTGCCCTGGTACTCGTCGATCGCTTCAGCAAAAT
GGTCCACTTTGCTGCTGTCGCCGCCCAAGTTACCGCTGAGGAGACGGCCAGTCTGTTCCTCGAATTTGTATTCCGGCACCATGGCCTGCCGGAATCTATC
GTGTCCGACCGTGATCCCCGCTTTACTTCCGCGTTCTGGGACCGCCTCTTCGAGCTGCTTGGTACGCGCCTCCTCATGTCAACGGCGGCCCA