Description :
From Genome Similarity Track
Location :
Scaffold_246:1- 2975
Transcript NameFunction/comments
g12681.t1hypothetical protein

Sequence
2974 bases(100 bases per row)
CTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAATAGATCAACCCAGATCAGCAACTCCGTGTTGCCTCTATGCGATTTCGGCAGCGAAGGTATGT
GATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGACTCGCCTCGGATAGTTGGCCGACCTTTTCCGGTCTCGCAGTCTACACA
TTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGGTCTCGGATCCGCTGGTAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCT
ACACTAGCATGGTAGTGGTGCAGGATATCCTGCTGGAGGGTTTCGGGTGCAACCAACCGCATCGCAAGATCTCGATCTTCGTCAGACTTCCGGTTTGGTG
GACAGTAGAAGAGTAATCCGTCCAGATCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGAGCTTCTTCCTGGGCCAACGTAGCTACATCGCCAGC
CAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCCTGAGCTCCCTCACCAATTCTTCCTGCATTACCTTC
GGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAAACTCGGACCACGGATTCTTCGGACTGTACGGTTAGAATCTCGTCCAACCGGTTTA
GGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCTGACTGTCGCTGAAGGGCAGCTCCGGCGAGGCTGTCAGCGGAACCATTCCAGTCTCG
CTTAACATGTAGCAGTTCGTGATTTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCAAACCTGGGGCCTTACAATCAATTTCTCCT
CTCACTTGCCGGATCACCAAGTTGGAATCCCCGCAGATCACTAAACGTCCACGCCTCACTTCAGCCAGGAGGTCGAAACACAACAAGAGACCATTATACT
TCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGGTCGGGCTTTCAGCAGGGTCCATTCTGGTAGTTTCCACAGGATCGCGCTGTATGCGCCTCCTCC
TCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACAGGAGCTTGGATCTGCCGTCGGGGCTCTTTC
TTAGGCGCGATCGCGATCAACGCCTCTTCCACATCGGACCTAGGTGCAATACTAGCAGCCATCGCCCCTAGGATTTCGTCTTCACCTTTAGTGCACTTCA
TAATTTCAAGTGTCCATGGCGATAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATCGGAACAACCATGCTAACGTCGAATGTCGAGT
TAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAAATCCGTAGCAACGCCAGCACTTCCTTCTCGACCACATTATAATTCAGCTCG
TTCGATTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTTTGCATCAAGGCGGCGGAAATAGCCCATTCGCTAGCGAAGACAA
CTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGAGGCGATCTTGTCCTTCAACGCTGCAAACGACCTATATGCTCTGACCCATCT
CTCGTCAGCTACATCTACACCTGACATTACCAGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGGTTCAGACGAACTGTGATCCAGGATCCGACGA
AGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATCGCATAGTCCTCGATAAATCGGCTGTAATAGT
TCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCTTCGGATTAGCTTCGATGCCATCGTC
GGACACTCGGTGTCCCAAATATTCTACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCATTTATCACACGCTTCGAGCAGATTC
TCCACCCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCTGCGTCCTAACACTGACGGACGACCTGGATCTTCCG
GTTCTCCAGCCTCAAAGGGATCTGGAGCAAGTCCTGGCTCGTCAGTAGGCGGGATCCGTGTAAACCCATATAACGCATTATCCAGAAGCCGCTGATAGAT
CTGAGGCGCGTTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGATCGCGCGAGCTCGGTCCGTCATCGAC
ACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATTGATCAGAGGCATGGGGTAGATCATTA
GTCGAGTGAGACCGTTCACCAGTCGGTAGTCTATACATAGCCTGATGTCGATCCCGTTCTTTTTGATGATCACCACGATCGGTGATGCCCACGGTGATGT
CGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTATCTTCCGCACCCGTTGCACGATCGGC
TTCGCACCTCCTACATCGATATCACACACGACTCCTCGGGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAGCAAGTGTCGTTTCCGCCAGATGATCT
GCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGACATCGTCAATAGTCACTTCGCTCGTCATAGCCGTGATCTCTGGCAA
TACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGTGGTGATGAATATGCTCATCTTCCA