Description :
From Genome Similarity Track
Location :
Scaffold_3730:1- 2931
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3730-fgenesh-gene-0.0Callose synthase

Sequence
2929 bases(100 bases per row)
CACCGCAGTATCTTCACGCTCATGCTCAACTACTACCGGATCTTCCAGTTCAACCTCATGTTCCTCGTCGTGCTCATCGTGCTCGCCTTCTGCGTCACGG
TCTCGCCCGACGGCGGCAAGACGGGCTTTGCGCAGTTCGGCCAGCTCGGCAACACGGTCTTTCCGTTTGTCAAGCGCGACCTCAAGCTCTCGCTCGTCTC
GGTCGTGTTTTCGCTCGCGGGCCTCGGCTTTCTCAAGTGCGTGCTCGAAGTCGCCCACGGCTGGCACCTGCTCGTCTCGAACGAAGCCAAGGCGTCGTCA
TCGCGGTCGTTCACGTACGGCATGGCGCTCACGGCGCGGCTGCTCTGGAACGGCGGCTTTGCTGCGCTTTTTGGCATCATGATGTTTGTGGCCTACAACG
AGCAGCGCGACACGGCACTGCTGAACCAGTTCTGGCTGCTCGCCGGCGCGTTCGTGCTGCCCGGTCTGCTCGTTGTGCTCGTGCAGGTGTTCGCGCCGCA
GTTGATCACGGGCACGTTTGCTGCCAAGTTTGTGCGCGAAGGCGCGAGCTCGTACGTCGGCCGCAACATTGCGCCGCCGTTCATGTACCAGGTCCGGTAC
GGTCTCTTCTGGATCTTTCTTTGGGTGATCAAGGCCATCGTGTCGTACTTCATCTTGGTGCGTCCGCTCATGCTGCCGTCGATCGCGATCTACCAAATGG
ACTTGAGCAAGACGTACAAGGGTGGCGCCGTCGTGTCGTTCCACAACCTCGGCGTGATCATTGCGCTCTGGGCGCCCGTCGTGTTTGTCTTCAACTACGA
CACGCAGATTTACTTCACGATTCTCCAGGCGCTCACGGGCGCGTTCATGGGCATGCTCATGAAGACAGGCGAGATCCGAGGCGTCAAGGAGATGACCAAG
GCGTTCCGCGTGGCGCCGCAGCTCTTTGACCAGAAGATCGTCACGAGCCTTGCGCGCTCGACCGACGCCGCTGCCAACAACCTCGAAAGCTCGCGCGCCA
GTGCAGTCGCCGCGGCGTACGAGTCGCAGATGATGCTCCGCTTTGTGGTCGTCTGGAACGAGATTGTCAACTCGTTCCGGGAAACCGATCTGCTCGATGA
CAAGGAAGCCGCCATTCTCCAGTACGATATTCGCAGCAATGGCGAAGTCTTTGAGCCGGTCTTCCTCTCGGCGGGCAAGCTCGGAGAAGCCTTGGATCTT
GCCATGCGCTTGGCCAAGGAAGGCAAGGGCGAGTCGCAGCTGCGCGTCAGTCTCGTCGAGAGTGACTGCCTGTCGGCGATCCGCAGCTTTTACACGGCCG
GTTCGTTCGTGCTGAGTGCGCTGTTTGGCAACGACGATGCCGACGTCATGGACGGATTCCGCATGATCGAAGACATCGCGAGCTCGGGCGGCTTTATGAA
GTCGTTTAACGTCAGTGAGCTGCCGCGGCTTCGCCTGGCGGCGCTTGAACTGCTGGAAGCCGTGCTCGACCTGGAAGATCCCGATGTTCCGTCGCAGCAC
ATTCGCGATGCCAAGGTGCACAACCTCGGTGTGATCCGTAACTTTGTGACCAAGATGGAGATGTTCCTCGGCACGCTGCAGGCCTTCTGTGCAGAGCCGG
CGTTGCAGCACAAGTTTGCTAACGCCAAGTTCTGCTCGAGCGCGAACGGCTACCTCTATGCGACGCGTGGGCTCGTCAACCTGTTCTACAGTGACACTGC
CATGGGTGCGGCCACGCGCGCGTGCTTGCTGTTGTCGTTGGAACGCTCGGAAGCGATGCCCCGCTGTGGCGAAGCCGAGCGTCGATTGGGCTTCTTCATG
AAGTCGCTTGTTATGGACATTCCGCAGCTGCGTGCGATCAAGGAAATGCGGTCGTTCTCGGTCGTCACGCCATTCTACGCCGAGACGGTGCTGTTCTCGC
TGGAGGACCTGAACAACCCGCTGGTGAACCACCCGATTTTCCAGAAGGTCGAGGAGGATGGCAAGAACCTAACCATCTTGAAGTACTTGAGCAAGATCCA
CCCGGAAGAGTGGGAGAACTTTTTGGAACGCATTGACGTCAGCAGCGCCGACGAAGCCCAGGCCAAGCACCCGCAGGAGATCCGTCTGTGGGCGTCGTAC
CGCGGCCAGACGCTCGCTCGTACGGTGCAAGGTATGATGATGTATGAAGACGCGATCAAGATTCTCCACTGGCTCGAGATTGGCTCGAACCCGGGCAAGT
CGGCTGAGCAGAAGCAGCGCCAACTCCAGGATATGGTGCGGCTCAAGTTCTCGTACATCTGCGCGTGTCAAGTGTACGGTCAGCACCGCCGCGATAACAA
GCAACAGGCCGATGACATCGACTACCTTCTCCGCGAGTACCCGAACTTGCGTGTCGCGTACGTCGATTCGATCAAGTTGCACGATGGCAACACGGTGTTT
GACACAGTGCTCATCAAGAGTGAAGGCAACGAAATTGTCGAGGTGTACCGGTACCAGCTTCCAGGGGATCCGATCCTGGGCGAAGGCAAGCCCGAGAACC
AGAATAATGCGCTCCAGTTTACACGTGGCGAGTTTGTGCAGACCATCGACATGAACCAGGAACACTACTTTGAAGAGTGCCTGAAGATGCCGCAGCTTTT
GCTCACGGCCGATCTGCACCCGTCGCGCAAGCCCGTCCAAATCATTGGCATGCGCGAGCATATCTTTACCGGAAACGCCTCGTCGCTCGCCAAGTTCAAG
ACGTGGCAGGAACTCGTGTTTGTCACGCTCTCGCAGCGTGTGCTCGCGAACCCGCTGTACTGCCGCATGCACTATGGCCACCCGGATGTCTTTGACAAAG
TGCTCTCGATCACGCGTGGTGGACTGTCCAAGGCCAGTAAGGGCATTAACCTGTCGGAAGATGTGTTTGCCGGTTTCAACTGCACGCTGCGCGGCGGTGT
CGTCACGCACGTCGAGTTTATGCAGTGCG