Description :
From Genome Similarity Track
Location :
Scaffold_2376:1- 2928
Sequence
2927 bases(100 bases per row)
GGCGATCGGTTCCTCGAGTGACGCGGCAGTGGGTAAGCGAGCAAGCAAGCGCCGCAGCCCGTCGCCCTCGGCCTCTCCAGACAACTGCCCGAACCGGATG
GGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGCTACGACTTCCCGACAC
AGACGCGCTTGAAGAAGTACTGTGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGGTCCGGCAAGTATCGCCAAAAGGCTCCGACG
CCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTATAGTC
GAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCG
AGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGT
GGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGAATGAATTCTACAACC
AGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTA
CGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGTCCCTAGATCCAGTCGATAATACACGTGATC
TACATGAAGTGTCAGTTGCCGAGGTTTCTAGTTTGCGCCAAGTGGATGAATTCGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAAGC
GCTCGGGTACTGGGAGAAACGACAACATGGTCGATGGTTTGAGCCAACCATGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCT
CGTGGATCTGAGGAGGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGAATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGG
TAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCA
AGTGGATGGGAGTCGGATCCAATATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGAAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTG
GTATACTGGTTCGATATTTCCGTCGGAGATCTTGCTAGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGG
ATGGGACACTTTGTTTCCCCGACGAGATGCGGATCCAGCACAGCGGACGGCGACCGTTGTACGGGGTGAAGATGAGGATCATACGGGCGGATAAGACAAC
CTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAGGTGGGTGGAACATGTGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACC
GTGATCCAGAGACCAGGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTG
GCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGTCGTTGCAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCG
AATTTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCCACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACG
GGTTGAGATCCAAGCAATGGAAGTTGGATCCATGACGGGGGACGATCCCCAGCGTCGGCCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAG
GGCTAAAGCCGAACAGCCGGATCCCGCCGGTCCACAAGTGGATCCAAGCTTTCCCCTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACGCTAGTC
AAACCCGAACTGTCTGGTTTAGACTCGTTAGAGGACCGGCTGGATTCCGACCGGTGACTTCCCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGG
ATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCCGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACG
CCGAGGATCTTGGAGAATGTATGGCGGTAATCCCGGAGGTACCACTGACCACAGAAGAGGTCACGATCGATGATATCCAAGTGGATCCAGGGGCGAACGA
ACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCTGCCGCCCGCGGAGTCAAA
TGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGCTCCGAGAAAAACTGTCGGATCTGATTAAGGGCCTGC
TGCAAGACAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTA
CCGGCTGATTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTGATCAATGAACTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTA
GACATGGCCAGTGGTTTCTGGGTGGTT