Description :
From Genome Similarity Track
Location :
Scaffold_1135:1- 2919
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1135-fgenesh-gene-0.0Lipase domain protein
Pytiw_DAOMBR242034maker-piw_contig_1135-snap-gene-0.5Ankyrin repeat protein

Sequence
2918 bases(100 bases per row)
ACCTGCGTCAGCTGCCGTACATGTCGACGCGGTTCCAGCAGCTTTCCTTCCGGTTCCTCTTCCTCGAGACGCTGCTCATCCTGATATACGTGCTCGTGCT
CTCGGGCGTCCAGGTTTTCTTCCTTTGCCAGACGCTGTATCTCCTGGGCTACGGCCCGTTCATCCAGAGCGCAGTGCACACGTTCGTCAAGTTCCATTCG
GGTCGGCCGTCGCTGGGCGAGCTCATCTTCTTGTCCGTGTACGTCTACCTGGTCATGTTTGTGCATCTGCCGCCGGCGACAGGCGAAGGCAGCGGGTTGC
TAGCGACCACCGCGTTCCACGTCGAAGAGCGGCCGCGCGTCGACAAGTACGGCTTTTTGACGCCCGATTCGCACCTGTTCTGCGTCGAGACGGCTACGTG
GCTACTGGAGATCGCGTGGCAGGCGTACTTTGACCCACCCGGCCGGCCGTCGACCTCGGGCTACGGCGAGCTTGACCTCGAGCCCTACGGCTTTGAGCTC
ATTACGCACTTGAGAAGCAGCCTGACCGACACGCACGTGGTCGTGGCGCTCAACCACGACCACCGGCGGCTCGTGATCGCGTTTCGAGGCACGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGAACTGGAAGAGCAACT
TGCGTTTCCACCAGAAGGTGCTCTGGGTCAAATCGCGCGGCCGTTGGCGCAAGCGCACGTGCATGGAGGCCACCAAGGACGGGCTATCCAAGGTCCCACT
GCTCAACATGGCTCTGCCGCGGGTGCATAGTGGTAAGTGGATGTTTTTTTAATGTGGATGGCATGACATACACATACTTATTGGTGCAACTCTTGATGCA
GGCTTCTGGAAGGCGTACGTTTCGGTCCGGGACGAACTCAAGGAGGTGACGCGGCTGATCTTGGATGATAACCCGGGCGTGACGGTGTTCGTCACGGGCC
ACAGCATGGGCGGCGCGCTGGCGGTGCTCGCGGCCTACGATCTGGCCGTGAACTTCAGCATGAAGGTTAACATGTACAACTTCGGCGGCCCGCGCGTGGG
CAATCCCAGCTTCTGCCGCCACTACAACAAGTGCGTACCGTCGAGCTACCGCGTCGTGATGGACGGCGACATCGTGCCAGGCGTCCCGCGCTTTGTAAGT
TGATGATGATGATGCTTGTATCTATTTTGATCAATTGACTGACAGTGTTGCTGCTTTACATGATGTAGTGGGGCTTGTACCAGCACGTGGGCACCGAGGT
GGCGATCGACCTCGAAGGCAACCTGATCGTGGATCCCAGTTTCGTCGAGCGCCATCTGCACGTGTCGTCCAAGACGAACCTGGCGTCGCACCCAACCAAC
GTCTACCGGAACTCGATTGCCAAGTGCCTCGAGAACCTCACCTAATTAGATGTGCGTATCCTTCGTAGATTTTTATGAGCCAATTAACCATTTATCTTTT
CTTTTTCAAGAAGATGATCAAGTTGTGCGCTCAAGCCCTGCGAAACGGTGTCTGGGGTATCCGTTTCATCAACTGACCTCCCTTTCGGACGACTCGTGTG
TGTGACTGCTTTACTCAAAGAAAGCTAATATTTCATTCGTCGGCGACCAAGTTGCGGCGTGAGAAGAAGACAGAGCAGACGAAAATGGCTGACTATGAAG
ACCAGCAAGACCGTGAGGGTGTGATCCGATCGCATGTGGAGTTTGCCGAGGCTGCGGCAAATGGCTCACGGACCATGGTACAATCTCAATCAAATTCCGA
AGACTTGCATCTATTCAGCTCAGCATGGCTTTGTGTGTCGGTCTAGGTGGAATTTTTGCTTGAGAATGGTGCACACATCGACGCACCAGGACGAGGTCAG
TCTCTATAAGTCTCCTGGCAGCTCTAGCTCTCCCTGTGCCAAGGCAACAGGGTCGATTCTCTGCTGGATATATTGTCAGACTCACCAAATTTGCCTGCAT
TCAGATGGGACGACGCCAATCTGTGCCGCTGCGCTCTGGGGAAATGACTCGATGGTGAGCTTCCTGCTCGAGAAAGGAGCCGACATTAGCGCCCGGAACG
AAGGTACCCACCTCATTCCCCAGCTACAGCTCTGTTACAACATGTATCTTGAGCGAGTATATGGAATTATAGGAACCGGTTGGACTGCGCTGCACGCCGC
AGCTTTCCAGGAGCATGGTAAGGCTGTGCGCGTCCTCCTCGACCGCGGCGCCGACCCAAAGACCGCGGACGTTGAGGGCCGCACGCCCATCGACTATGCG
AGCATCTCGGAGGCGATCTGGCCCTTCTTCGCAGCCCGCGGATGTCGTCGGAGTCGAAAGTCCGAGCTCGTGGCCAAAGGAATTATTCGAAAGATCCAGG
ACCAGCCGGAGCAAACGTCCGGTGGCGACAGCAAATATGCGGAGAGCGTACGTGTGTTTATCTCCCAATGGCTCGCTATATCGCTATAGGAGTGATACGC
TTGTGAGACTAATTTTTGTGTTGTGAATGTTATTCTGATCATTTACCAGCTCTCGTCGTTCTCGCGACCGGGCTCGTCGTACACGCGAGCGCAATTCCAG
TTGCCCGTGGCGAAGCGCCAGGGCACAGCAGCCAAGGTACGCGTTTGTTTTTTGTTAATACGTCGAAGTGAAATTGTTATCGCATCATCTGAACCAATTT
GATGTGTGCAGTCACGTGATGGAAGACCGACTGGTCCGATTGACCCGCTGGGCGACGCGCCAGCGCTGCCGCGGCTGTCGAACCAGCGCCGCCCATCTCT
CCAAGGTCTCGGTCTGTA