Description :
From Genome Similarity Track
Location :
Scaffold_2528:1- 2916
Sequence
2915 bases(100 bases per row)
TGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTACATCGATGTCACATTTGACT
CCGGTGGCAGCGGGCGGTAACGCATTTCCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTAACGCAGACGATCCACTTCAGCAGGTTCATTCG
CCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAG
AAATCTCCGCTCTCACGCTAAACAGAACTTGCTCGTCCTTCGCTCTTCGCTAGGAATCCACCACATTGGAATACTCAAACAACGCGCGCCCTCTCTCCCC
TGGCAGTCCTTCTATTCTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCG
GGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAAGGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTT
TAACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTC
AACCCGTCGATCCCTCTGCAGGATCGTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGA
GATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCGTTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCT
TCGCCAACCGTCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGAT
TACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCAAGTTTCCTCGGGCTCGATC
CAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTGAGGGAAACAAAGTGTCC
CATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCACGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATA
CACCAAACAACCTGCCAGCGTGATCTTGATCCGCGCTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCC
ACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCC
CAGCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCA
CAGGATCCAGTGACCAGACAGACCTTAAGTGGATCTGCAGTGACCTCACGCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAAACAC
GTGCCTCTCCCATTTGTATATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATG
TAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCT
CGTACCGGATTTAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGAT
CTGGTTGTAGAATTCTTCCATCGGCCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTG
CCACACTTCTCACAGACCAGATGTTTCCAGCATCCTGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGAT
CTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATTCCCCGGTCGGGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGAC
CCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCATTTCCTGAGTCGGGCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGC
GTCGGAGCCTTTTGGCGATACTTGCTGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTG
CGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGACCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCC
ATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGGAGTATTGT
CGTGCCACCGACACTCCCAATTTACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGT
TCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGAATTGACTTTGCTTATCCATGT
TCTCGCTCGGTCCTC